Order Kazusa clone(s) from : ![]() |
Product ID | ORK05884 |
---|---|
Accession No | AB058693 |
Description | leucine-rich repeat kinase 1 |
Clone name | fh24104 |
Vector information | |
cDNA sequence | DNA sequence (5370 bp) Predicted protein sequence (1369 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1790
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1258 bp |
---|---|
Genome contig ID | gi51511731f_99280195 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (147641 - 147690) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | f | 99380195 | 99427834 | 20 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 651 | 865 | PD000001 | Protein kinase |
HMMPfam | IPR013684 | 1 | 114 | PF08477 | Miro-like |
IPR000719 | 596 | 874 | PF00069 | Protein kinase | |
HMMSmart | IPR001245 | 596 | 874 | SM00219 | Tyrosine protein kinase |
IPR002290 | 596 | 879 | SM00220 | Serine/threonine protein kinase | |
ProfileScan | IPR000719 | 596 | 879 | PS50011 | Protein kinase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 969 | NTPQQALDTPAVVTCFLAVPVI | 990 | SECONDARY | 22 | 2 | 994 | SYLVLAGLADGLVAVFPVVRGTP | 1016 | PRIMARY | 23 |
---|
![]() |
Primer_f | CTACCTCAGTGTGGAATCTTC |
---|---|
Primer_r | GCGGGAAACCACTGATCAATC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |