KIAA1470

Product ID	ORK00845
Accession No	AB040903
Description	regulator of chromosome condensation 2, transcript variant 1
Clone name	fj01953
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4028 bp) Predicted protein sequence (564 aa)
HaloTag ORF Clone	FHC00845
Flexi ORF Clone	FXC00845
Source	Human fetal brain
Rouge ID	mKIAA1470 by Kazusa Mouse cDNA Project

Length: 4028 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2310 bp
Genome contig ID	gi89161185r_17505866
PolyA signal sequence (AGTAAA,-16)	+--------+--------+----*----+---- TTATATATATATTTCTTGGAGTAAACATTTTAAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACAACAACATTGTCTACTGTCTTGGATTTTGCATTTCTTTTTCGGTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	17605866	17638768	13	99.4	Perfect prediction

Length: 564 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9P258	8e-200	100.0	Protein RCC2; T...	Homo sapiens
XP_544537	2.3e-196	98.5	similar to RCC1...	Canis lupus fam...
AAI47876	5.2e-196	98.3	RCC2 protein [B...	Bos taurus
Q8BK67	5.8e-193	96.0	Protein RCC2.	Mus musculus
AAI42947	1e-172	99.6	RCC2 protein [H...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D25215	2.8e-10	29.1	KIAA0032
AB046813	8.6e-10	31.6	KIAA1593
AB037838	3.3e-07	27.6	KIAA1417
AB046783	5.2e-06	28.3	KIAA1563

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000408	212	228	PR00633	Regulator of chromosome condensation
	IPR000408	246	259	PR00633	Regulator of chromosome condensation
	IPR000408	265	281	PR00633	Regulator of chromosome condensation
	IPR000408	377	393	PR00633	Regulator of chromosome condensation
	IPR000408	393	407	PR00633	Regulator of chromosome condensation
HMMPfam	IPR000408	210	259	PF00415	Regulator of chromosome condensation
HMMPfam	IPR000408	262	311	PF00415	Regulator of chromosome condensation
ProfileScan	IPR000408	211	262	PS50012	Regulator of chromosome condensation
	IPR000408	263	314	PS50012	Regulator of chromosome condensation
	IPR000408	315	390	PS50012	Regulator of chromosome condensation
	IPR000408	391	444	PS50012	Regulator of chromosome condensation
	IPR000408	490	544	PS50012	Regulator of chromosome condensation
ScanRegExp	IPR000408	249	259	PS00626	Regulator of chromosome condensation
ScanRegExp	IPR000408	377	387	PS00626	Regulator of chromosome condensation

Primer_f	CAGATAATGTACAACGGCCAG
Primer_r	CTTCCCATCTGAGTTGTGTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AATGTGCTTGGCGCTGACCTG
Primer_r	TTCGACCAAATCACAACCTCC
PCR product length	114 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles