KIAA1692

Gene/Protein Characteristic Table for KIAA1692

Order Kazusa clone(s) from :

Product ID	ORK00267
Accession No	AB051479
Description	ventricular zone expressed PH domain-containing 1, transcript variant 1
Clone name	fj05607
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4119 bp) Predicted protein sequence (855 aa)
HaloTag ORF Clone	FHC00267
Flexi ORF Clone	FXC00267
Source	Human fetal brain

Length: 4119 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	158460228	158703830	14	100.0	Perfect prediction

Features of the protein sequence

Description

Length: 855 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14D04	100.0	Ventricular zon...	Homo sapiens
AAI01661	99.9	Ventricular zon...	Homo sapiens
CAD28465	99.9	hypothetical pr...	Homo sapiens
BAB55243	99.8	unnamed protein...	Homo sapiens
XP_001152820	99.4	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	739	841	PF00169	Pleckstrin-like
HMMSmart	IPR001849	739	843	SM00233	Pleckstrin-like
ProfileScan	IPR001849	738	841	PS50003	Pleckstrin-like

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TGTAAATCAAGATGGCCAGCC
Primer_r	GAGTTCTATTGGGCAGTCGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 3

Experimental conditions

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp