Gene/Protein Characteristic Table for KIAA1692
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00267
Accession No AB051479
Description ventricular zone expressed PH domain-containing 1, transcript variant 1
Clone name fj05607
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4119 bp)
Predicted protein sequence (855 aa)
Flexi ORF Clone FXC00267
Source Human fetal brain
Features of the cloned cDNA sequence
Description

Length: 4119 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 3 r 158460228 158703830 14 100.0 Perfect prediction
Features of the protein sequence
Description

Length: 855 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q14D04 0 100.0 Ventricular zon...
Homo sapiens
AAI01661 0 99.9 Ventricular zon...
Homo sapiens
CAD28465 0 99.9 hypothetical pr...
Homo sapiens
BAB55243 0 99.8 unnamed protein...
Homo sapiens
XP_001152820 0 99.4 hypothetical pr...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001849 739 841 PF00169 Pleckstrin-like
HMMSmart IPR001849 739 843 SM00233 Pleckstrin-like
ProfileScan IPR001849 738 841 PS50003 Pleckstrin-like
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TGTAAATCAAGATGGCCAGCC
Primer_r GAGTTCTATTGGGCAGTCGTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 3
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp