KIAA1867

Product ID	ORK00291
Accession No	AB058770
Description	kin of IRRE like 3 (Drosophila), transcript variant 1
Clone name	fj18636
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3808 bp) Predicted protein sequence (779 aa)
HaloTag ORF Clone	FHC00291
Flexi ORF Clone	FXC00291
Source	Human fetal brain
Rouge ID	mKIAA1867 by Kazusa Mouse cDNA Project

Length: 3808 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	1221 bp
Genome contig ID	gi51511727r_125698464
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ATCATCCTAGACAATAAAGGCAGTTGATAGCTCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTGTGGTGGCAATTAAACCTACAGGCTGACTCCTCTCCCCTGTGGGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	125798464	126375865	17	99.6	Perfect prediction

Length: 779 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8IZU9	100.0	Kin of IRRE-lik...	Homo sapiens
Q8BR86	97.9	Kin of IRRE-lik...	Mus musculus
EDL25368	97.9	kin of IRRE lik...	Mus musculus
EAW67698	100.0	kin of IRRE lik...	Homo sapiens
XP_546407	96.5	similar to kin ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D86983	2.9e-13	26.9	KIAA0230
AB032958	9.6e-11	24.9	KIAA1132
AB002341	4.8e-07	23.6	KIAA0343
AB040929	5.9e-07	23.6	KIAA1496

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013106	49	145	PF07686	Immunoglobulin V-set
	IPR013162	151	239	PF08205	CD80-like
	IPR013098	336	417	PF07679	Immunoglobulin I-set
	IPR013098	420	517	PF07679	Immunoglobulin I-set
HMMSmart	IPR003599	55	145	SM00409	Immunoglobulin subtype
	IPR003598	61	135	SM00408	Immunoglobulin subtype 2
	IPR003599	156	248	SM00409	Immunoglobulin subtype
	IPR003598	162	235	SM00408	Immunoglobulin subtype 2
	IPR003599	342	418	SM00409	Immunoglobulin subtype
	IPR003598	348	406	SM00408	Immunoglobulin subtype 2
	IPR003599	426	518	SM00409	Immunoglobulin subtype
ProfileScan	IPR007110	49	143	PS50835	Immunoglobulin-like
	IPR007110	148	244	PS50835	Immunoglobulin-like
	IPR007110	250	331	PS50835	Immunoglobulin-like
	IPR007110	336	416	PS50835	Immunoglobulin-like
	IPR007110	420	516	PS50835	Immunoglobulin-like

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	9	LLFVCFFLFSQELGLQKRGCCLV	31	SECONDARY	23
SOSUI2	2	537	VIIGVAVGAGVAFLVLMATIVAF	559	PRIMARY	23

Primer_f	CAGCCAAAAATGATATCCGAG
Primer_r	GTGCTCTTTGAAGGTGTTGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-