Gene/Protein Characteristic Table for KIAA1827
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07489
Accession No AB058730
Description zinc finger protein 528
Clone name fk01409
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3072 bp)
Predicted protein sequence (469 aa)
Source Human fetal brain
Features of the cloned cDNA sequence
Description

Length: 3072 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 1662 bp
Genome contig ID gi42406306f_57510411
PolyA signal sequence
(AATAAA,-20)		 
+----*----+----*----+----*----+----
TCTCATGTTTGTAGTAATAAAGTTTCATTTTTCCT
Flanking genome sequence
(103055 - 103104)		 
----+----*----+----*----+----*----+----*----+----*
AAGTATGAATGAATCGTGTTTTCTACCGTCATAATTTCATCCCACCTCAG

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 19 f 57610411 57613464 1 99.0 Terminal No-hit
Features of the protein sequence
Description

Length: 469 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q3MIS6 2.2e-203 99.8 Zinc finger pro...
 Homo sapiens
XP_001116645 2e-195 95.5 similar to zinc...
 Macaca mulatta
EAW72078 3.4e-173 100.0 zinc finger pro...
 Homo sapiens
CAD89949 8.2e-173 99.7 hypothetical pr...
 Homo sapiens
BAB15732 1.5e-127 61.8 FLJ00032 protei...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB046831 5.5e-89 61.8 KIAA1611
AB107355 1.2e-80 55.3 KIAA2033
AB037770 7.5e-78 54.9 KIAA1349
D31763 2.4e-76 54.1 KIAA0065
AB075827 9.2e-75 51.4 KIAA1947
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 54 77 PD000003 Zinc finger
IPR007087 82 105 PD000003 Zinc finger
IPR007087 110 133 PD000003 Zinc finger
IPR007087 138 161 PD000003 Zinc finger
IPR007087 166 189 PD000003 Zinc finger
IPR007087 194 217 PD000003 Zinc finger
IPR007087 222 245 PD000003 Zinc finger
IPR007087 250 273 PD000003 Zinc finger
IPR007087 306 329 PD000003 Zinc finger
IPR007087 334 357 PD000003 Zinc finger
IPR007087 362 385 PD000003 Zinc finger
IPR007087 390 413 PD000003 Zinc finger
IPR007087 418 440 PD000003 Zinc finger
IPR007087 446 469 PD000003 Zinc finger
HMMPfam IPR007087 54 76 PF00096 Zinc finger
IPR007087 82 104 PF00096 Zinc finger
IPR007087 110 132 PF00096 Zinc finger
IPR007087 138 160 PF00096 Zinc finger
IPR007087 166 188 PF00096 Zinc finger
IPR007087 194 216 PF00096 Zinc finger
IPR007087 222 244 PF00096 Zinc finger
IPR007087 250 272 PF00096 Zinc finger
IPR007087 278 300 PF00096 Zinc finger
IPR007087 306 328 PF00096 Zinc finger
IPR007087 334 356 PF00096 Zinc finger
IPR007087 362 384 PF00096 Zinc finger
IPR007087 390 412 PF00096 Zinc finger
IPR007087 418 440 PF00096 Zinc finger
IPR007087 446 468 PF00096 Zinc finger
HMMSmart IPR015880 54 76 SM00355 Zinc finger
IPR015880 82 104 SM00355 Zinc finger
IPR015880 110 132 SM00355 Zinc finger
IPR015880 138 160 SM00355 Zinc finger
IPR015880 166 188 SM00355 Zinc finger
IPR015880 194 216 SM00355 Zinc finger
IPR015880 222 244 SM00355 Zinc finger
IPR015880 250 272 SM00355 Zinc finger
IPR015880 278 300 SM00355 Zinc finger
IPR015880 306 328 SM00355 Zinc finger
IPR015880 334 356 SM00355 Zinc finger
IPR015880 362 384 SM00355 Zinc finger
IPR015880 390 412 SM00355 Zinc finger
IPR015880 418 440 SM00355 Zinc finger
IPR015880 446 468 SM00355 Zinc finger
ProfileScan IPR007087 54 81 PS50157 Zinc finger
IPR007087 82 109 PS50157 Zinc finger
IPR007087 110 137 PS50157 Zinc finger
IPR007087 138 165 PS50157 Zinc finger
IPR007087 166 193 PS50157 Zinc finger
IPR007087 194 221 PS50157 Zinc finger
IPR007087 222 249 PS50157 Zinc finger
IPR007087 250 277 PS50157 Zinc finger
IPR007087 278 305 PS50157 Zinc finger
IPR007087 306 333 PS50157 Zinc finger
IPR007087 334 361 PS50157 Zinc finger
IPR007087 362 389 PS50157 Zinc finger
IPR007087 390 417 PS50157 Zinc finger
IPR007087 418 445 PS50157 Zinc finger
IPR007087 446 469 PS50157 Zinc finger
ScanRegExp IPR007087 56 76 PS00028 Zinc finger
IPR007087 84 104 PS00028 Zinc finger
IPR007087 112 132 PS00028 Zinc finger
IPR007087 140 160 PS00028 Zinc finger
IPR007087 168 188 PS00028 Zinc finger
IPR007087 196 216 PS00028 Zinc finger
IPR007087 224 244 PS00028 Zinc finger
IPR007087 252 272 PS00028 Zinc finger
IPR007087 280 300 PS00028 Zinc finger
IPR007087 308 328 PS00028 Zinc finger
IPR007087 336 356 PS00028 Zinc finger
IPR007087 364 384 PS00028 Zinc finger
IPR007087 392 412 PS00028 Zinc finger
IPR007087 420 440 PS00028 Zinc finger
IPR007087 448 468 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CTGATTTAGAGAGCATGGAGG
Primer_r CCTATGCCTTAAGATTACAGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp