Order Kazusa clone(s) from : ![]() |
Product ID | ORK05769 |
---|---|
Accession No | AB067487 |
Description | kelch-like family member 32 |
Clone name | fk07650 |
Vector information | |
cDNA sequence | DNA sequence (3221 bp) Predicted protein sequence (582 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1900
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1472 bp |
---|---|
Genome contig ID | gi89161210f_97430685 |
PolyA signal sequence (AATAAA,-27) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (264668 - 264717) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | f | 97530685 | 97695351 | 9 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013069 | 2 | 101 | PF00651 | BTB/POZ |
IPR011705 | 106 | 207 | PF07707 | BTB/Kelch-associated | |
IPR006652 | 297 | 347 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 349 | 395 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 397 | 443 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 445 | 495 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 503 | 548 | PF01344 | Kelch repeat type 1 | |
HMMSmart | IPR000210 | 4 | 101 | SM00225 | BTB/POZ-like |
IPR006652 | 252 | 308 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 309 | 360 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 361 | 408 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 409 | 456 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 457 | 509 | SM00612 | Kelch repeat type 1 | |
ProfileScan | IPR000210 | 4 | 71 | PS50097 | BTB/POZ-like |
![]() |
Primer_f | TGCTGGATATGTGGCTGATGG |
---|---|
Primer_r | GATCCGGTCATTATTGTAGTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |