Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05401 |
---|---|
Accession No | AB040968 |
Description | hyperpolarization activated cyclic nucleotide gated potassium channel 3 |
Clone name | fk12792 |
Vector information | |
cDNA sequence | DNA sequence (3522 bp) Predicted protein sequence (711 aa) |
Source | Human fetal brain |
Note | We replaced fh09002, former representative clones for KIAA1535 with fk12792. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1384 bp |
---|---|
Genome contig ID | gi89161185f_153414193 |
PolyA signal sequence (TATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (112071 - 112120) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 153514193 | 153526262 | 8 | 99.4 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR003938 | 25 | 34 | PR01463 | EAG/ELK/ERG potassium channel |
IPR003938 | 67 | 77 | PR01463 | EAG/ELK/ERG potassium channel | |
IPR003938 | 78 | 87 | PR01463 | EAG/ELK/ERG potassium channel | |
IPR003938 | 197 | 207 | PR01463 | EAG/ELK/ERG potassium channel | |
IPR003938 | 279 | 288 | PR01463 | EAG/ELK/ERG potassium channel | |
IPR003938 | 443 | 451 | PR01463 | EAG/ELK/ERG potassium channel | |
HMMPfam | IPR013621 | 1 | 61 | PF08412 | Ion transport N-terminal |
IPR005821 | 65 | 283 | PF00520 | Ion transport | |
IPR000595 | 383 | 468 | PF00027 | Cyclic nucleotide-binding | |
HMMSmart | IPR000595 | 365 | 478 | SM00100 | Cyclic nucleotide-binding |
ProfileScan | IPR000595 | 365 | 471 | PS50042 | Cyclic nucleotide-binding |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 25 | PYSDFRFYWDLIMLLLMVGNLIV | 47 | SECONDARY | 23 | 2 | 180 | DLASAVVRIFNLIGMMLLLCHWD | 202 | PRIMARY | 23 | 3 | 263 | WLTMLSMIVGATCYAMFIGHATA | 285 | SECONDARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | CTTCTGAGTTTGCTGTTGGTG |
---|---|
Primer_r | TGGTCCCACAGTCTTTAATGC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTTCTGAGTTTGCTGTTGGTG |
Primer_r | TGGTCCCACAGTCTTTAATGC |
PCR product length | 171 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |