|
Order Kazusa clone(s) from : |
| Product ID | ORK05401 |
|---|---|
| Accession No | AB040968 |
| Description | hyperpolarization activated cyclic nucleotide gated potassium channel 3 |
| Clone name | fk12792 |
| Vector information | |
| cDNA sequence | DNA sequence (3522 bp) Predicted protein sequence (711 aa) |
| Source | Human fetal brain |
| Note | We replaced fh09002, former representative clones for KIAA1535 with fk12792. (2005/08/06) |
Length: 3522 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 1384 bp |
|---|---|
| Genome contig ID | gi89161185f_153414193 |
| PolyA signal sequence (TATAAA,-18) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (112071 - 112120) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 1 | f | 153514193 | 153526262 | 8 | 99.4 | Perfect prediction |
Length: 711 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| FPrintScan | IPR003938 | 25 | 34 | PR01463 | EAG/ELK/ERG potassium channel |
| IPR003938 | 67 | 77 | PR01463 | EAG/ELK/ERG potassium channel | |
| IPR003938 | 78 | 87 | PR01463 | EAG/ELK/ERG potassium channel | |
| IPR003938 | 197 | 207 | PR01463 | EAG/ELK/ERG potassium channel | |
| IPR003938 | 279 | 288 | PR01463 | EAG/ELK/ERG potassium channel | |
| IPR003938 | 443 | 451 | PR01463 | EAG/ELK/ERG potassium channel | |
| HMMPfam | IPR013621 | 1 | 61 | PF08412 | Ion transport N-terminal |
| IPR005821 | 65 | 283 | PF00520 | Ion transport | |
| IPR000595 | 383 | 468 | PF00027 | Cyclic nucleotide-binding | |
| HMMSmart | IPR000595 | 365 | 478 | SM00100 | Cyclic nucleotide-binding |
| ProfileScan | IPR000595 | 365 | 471 | PS50042 | Cyclic nucleotide-binding |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 25 | PYSDFRFYWDLIMLLLMVGNLIV | 47 | SECONDARY | 23 | 2 | 180 | DLASAVVRIFNLIGMMLLLCHWD | 202 | PRIMARY | 23 | 3 | 263 | WLTMLSMIVGATCYAMFIGHATA | 285 | SECONDARY | 23 |
|---|
RT-PCR-ELISA
|
Experimental conditions| Primer_f | CTTCTGAGTTTGCTGTTGGTG |
|---|---|
| Primer_r | TGGTCCCACAGTCTTTAATGC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 1
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | CTTCTGAGTTTGCTGTTGGTG |
| Primer_r | TGGTCCCACAGTCTTTAATGC |
| PCR product length | 171 bp |
| PCR conditions | 95 °C 15 sec 62 °C 60 sec 30 cycles |