KIAA0010

Product ID	ORK01048
Accession No	D13635
Description	ubiquitin protein ligase E3C
Clone name	ha00408
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5160 bp) Predicted protein sequence (1086 aa)
HaloTag ORF Clone	FHC01048
Flexi ORF Clone	FXC01048
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0010 by Kazusa Mouse cDNA Project

Length: 5160 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1605 bp
Genome contig ID	gi89161213f_156524425
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- ATGGCTAAACATTTACATTAAATATTTTTTTTCCC
Flanking genome sequence (230400 - 230449)	----+--------+--------+--------+--------+----* AAGATTGTGTTGGAGTCCTACCCCAAATCATTGTGATTAGCACAGCTTCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	156624425	156754823	23	99.6	Perfect prediction

Length: 1086 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11121	100.0	ubiquitin-prote...	synthetic construct
Q15386	99.9	Ubiquitin-prote...	Homo sapiens
XP_528010	98.7	ubiquitin prote...	Pan troglodytes
XP_539937	95.3	similar to Ubiq...	Canis lupus fam...
Q80U95	93.3	Ubiquitin-prote...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007899	1.2e-32	32.3	KIAA0439
AB002310	1.4e-32	32.6	KIAA0312
D42055	1.7e-31	31.8	KIAA0093
AB046845	4.1e-31	31.7	KIAA1625
AB037741	6.2e-30	32.0	KIAA1320

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000048	49	69	PF00612	IQ calmodulin-binding region
HMMPfam	IPR000569	781	1086	PF00632	HECT
HMMSmart	IPR000048	47	69	SM00015	IQ calmodulin-binding region
HMMSmart	IPR000569	745	1086	SM00119	HECT
ProfileScan	IPR000048	48	77	PS50096	IQ calmodulin-binding region
ProfileScan	IPR000569	747	1086	PS50237	HECT

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TCATCCGCTCGCCCTCCTTT
Primer_r	ACTGCAAGAACTACCGACAC
PCR product length	169 bp
PCR conditions	95 °C15 sec58 °C60 sec30 cycles