KIAA0053

Product ID	ORK00387
Accession No	D29642
Description	Rho GTPase activating protein 25, transcript variant 2
Clone name	ha01417
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2739 bp) Predicted protein sequence (666 aa)
HaloTag ORF Clone	FHC00387
Flexi ORF Clone	FXC00387
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0053 by Kazusa Mouse cDNA Project

Length: 2739 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	629 bp
Genome contig ID	gi89161199f_68755624
PolyA signal sequence (AATAAA,-15)	+--------+--------+----*----+---- TGATGAGAAAATTATATTCAAATAAAGCAAAATTT
Flanking genome sequence (151837 - 151886)	----+--------+--------+--------+--------+----* AAAAAAAAAAGGCTATTGCTAATCCATACGGCACCTTTGTGAGAATTAGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	68855624	68907459	10	99.7	Perfect prediction

Length: 666 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P42331	100.0	Rho GTPase-acti...	Homo sapiens
EAW99866	99.8	Rho GTPase acti...	Homo sapiens
XP_001135891	99.5	Rho GTPase acti...	Pan troglodytes
XP_001135811	99.4	Rho GTPase acti...	Pan troglodytes
NP_001007232	100.0	Rho GTPase acti...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007925	2.9e-07	23.8	KIAA0456
AB007871	7.7e-07	28.4	KIAA0411
AB018255	8.1e-07	26.6	KIAA0712
AB040934	1.7e-06	24.9	KIAA1501
AB037725	1.7e-06	29.3	KIAA1304

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	68	172	PF00169	Pleckstrin-like
HMMPfam	IPR000198	198	351	PF00620	RhoGAP
HMMSmart	IPR001849	68	174	SM00233	Pleckstrin-like
HMMSmart	IPR000198	195	371	SM00324	RhoGAP
ProfileScan	IPR001849	67	172	PS50003	Pleckstrin-like
ProfileScan	IPR000198	180	374	PS50238	RhoGAP

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	GCCCCTTTCTCAGTGCTATCT
Primer_r	TCTCTGCTCACCCTCACCTTC
PCR product length	134 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles