|
Order Kazusa clone(s) from : |
| Product ID | ORK01589 |
|---|---|
| Accession No | D83783 |
| Description | mediator complex subunit 12 |
| Clone name | ha02370 |
| Vector information | |
| cDNA sequence | DNA sequence (6604 bp) Predicted protein sequence (2124 aa) |
| Source | Myeloblast cell line (KG-1) |
| Rouge ID |
mKIAA0192
by Kazusa Mouse cDNA Project
|
Length: 6604 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 229 bp |
|---|---|
| Genome contig ID | gi89161218f_70156008 |
| PolyA signal sequence (AATACA,-20) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (123016 - 123065) |
----+----*----+----*----+----*----+----*----+----* |
Length: 2124 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| None | - | - | - | - | - |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 221 | KLLLPLLLRYSGEFVQSAYLSR | 242 | SECONDARY | 22 | 2 | 307 | FGLSCILQTILLCCPSALVWHYS | 329 | PRIMARY | 23 |
|---|
Chromosome No. X
Experimental conditions| Panel name | Genebridge 4 |
|---|---|
| Primer_f | CGTTGTAATACCCTTCCTGAC |
| Primer_r | TTTTGGCTAGTTGCGTGAGTG |
| PCR product length | 151 bp |
| PCR conditions | 95 °C 15 sec 62 °C 60 sec 30 cycles |