KIAA0230

Product ID	ORK00470
Accession No	D86983
Description	peroxidasin
Clone name	ha02538
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5510 bp) Predicted protein sequence (1496 aa)
HaloTag ORF Clone	FHC00470
Flexi ORF Clone	FXC00470
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0230 by Kazusa Mouse cDNA Project

Length: 5510 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1019 bp
Genome contig ID	gi89161199r_1515964
PolyA signal sequence (None)	+--------+--------+----*----+---- GGGAACTGTCTAACTTCAGGTTGTGTGAGTGCGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAGAATCCCTATACCTCATTTGTATTTTTAAAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	1615964	1727285	23	99.5	Perfect prediction

Length: 1496 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92626	100.0	Peroxidasin hom...	Homo sapiens
AAI50790	91.3	Peroxidasin hom...	Mus musculus
Q3UQ28	91.2	Peroxidasin hom...	Mus musculus
XP_001381381	87.3	hypothetical pr...	Monodelphis dom...
XP_001503092	90.7	peroxidasin hom...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046788	2.3e-25	30.3	KIAA1568
AB011537	7.1e-20	35.5	KIAA0813
AB040947	3.4e-18	28.7	KIAA1514
AB002341	3.6e-16	33.2	KIAA0343
AB040898	5.3e-16	28.4	KIAA1465

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002007	782	793	PR00457	Haem peroxidase
	IPR002007	834	849	PR00457	Haem peroxidase
	IPR002007	988	1006	PR00457	Haem peroxidase
	IPR002007	1006	1026	PR00457	Haem peroxidase
	IPR002007	1031	1057	PR00457	Haem peroxidase
	IPR002007	1084	1094	PR00457	Haem peroxidase
	IPR002007	1211	1231	PR00457	Haem peroxidase
	IPR002007	1282	1296	PR00457	Haem peroxidase
HMMPfam	IPR001611	80	102	PF00560	Leucine-rich repeat
	IPR001611	104	126	PF00560	Leucine-rich repeat
	IPR001611	128	150	PF00560	Leucine-rich repeat
	IPR001611	152	174	PF00560	Leucine-rich repeat
	IPR001611	176	198	PF00560	Leucine-rich repeat
	IPR000483	236	261	PF01463	Cysteine-rich flanking region
	IPR013098	263	350	PF07679	Immunoglobulin I-set
	IPR013098	359	446	PF07679	Immunoglobulin I-set
	IPR013098	450	536	PF07679	Immunoglobulin I-set
	IPR013098	542	628	PF07679	Immunoglobulin I-set
	IPR002007	756	1309	PF03098	Haem peroxidase
	IPR001007	1432	1487	PF00093	von Willebrand factor
HMMSmart	IPR003591	82	101	SM00369	Leucine-rich repeat
	IPR003591	102	125	SM00369	Leucine-rich repeat
	IPR003591	126	149	SM00369	Leucine-rich repeat
	IPR003591	150	173	SM00369	Leucine-rich repeat
	IPR003591	174	197	SM00369	Leucine-rich repeat
	IPR000483	209	261	SM00082	Cysteine-rich flanking region
	IPR003599	269	353	SM00409	Immunoglobulin subtype
	IPR003598	275	341	SM00408	Immunoglobulin subtype 2
	IPR003599	365	447	SM00409	Immunoglobulin subtype
	IPR003598	371	436	SM00408	Immunoglobulin subtype 2
	IPR003599	456	537	SM00409	Immunoglobulin subtype
	IPR003598	462	526	SM00408	Immunoglobulin subtype 2
	IPR003599	548	629	SM00409	Immunoglobulin subtype
	IPR003598	554	618	SM00408	Immunoglobulin subtype 2
	IPR001007	1432	1487	SM00214	von Willebrand factor
ProfileScan	IPR007110	263	349	PS50835	Immunoglobulin-like
	IPR007110	359	445	PS50835	Immunoglobulin-like
	IPR007110	450	537	PS50835	Immunoglobulin-like
	IPR007110	538	627	PS50835	Immunoglobulin-like
	IPR002007	746	1333	PS50292	Haem peroxidase
	IPR001007	1430	1488	PS50184	von Willebrand factor
ScanRegExp	IPR001007	1451	1487	PS01208	von Willebrand factor

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CTTCATCCCATTGTGTATCTG
Primer_r	AAGTTAGACAGTTCCCGACAC
PCR product length	162 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles