KIAA1089

Product ID	ORK00736
Accession No	AB029012
Description	SMG5 nonsense mediated mRNA decay factor
Clone name	ha02541
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4563 bp) Predicted protein sequence (1033 aa)
HaloTag ORF Clone	FHC00736
Flexi ORF Clone	FXC00736
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA1089 by Kazusa Mouse cDNA Project
Note	We replaced hk03401, former representative clones for KIAA1089 with ha02541. (2002/5/10)

Length: 4563 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1361 bp
Genome contig ID	gi89161185r_154385641
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AGACTAAAGCATCACTTAATAAACCCCCCAAGCCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATCCCTGTCTCCTGGTGCCTGTCTGTACAGAAGTTTCATTGGGGGGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	154485641	154519233	22	99.6	Terminal No-hit

Length: 1033 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_513880	99.6	Est1p-like prot...	Pan troglodytes
Q9UPR3	100.0	Protein SMG5; S...	Homo sapiens
AAH38296	99.9	Smg-5 homolog, ...	Homo sapiens
AAQ84301	99.7	LPTS interactin...	Homo sapiens
AAI34681	96.2	SMG5 protein [B...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87437	7.1e-07	25.0	KIAA0250
AB018275	1.7e-05	24.8	KIAA0732

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR006596	872	995	SM00670	Nucleotide binding protein

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	365	AFLPDLLIFQMVIICLMCVHSLE	387	PRIMARY	23

Primer_f	GGAGCAGAGATCATGAATAGC
Primer_r	GCCAACTATCCTCTAAGCCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GGAGCAGAGATCATGAATAGC
Primer_r	GCCAACTATCCTCTAAGCCAC
PCR product length	211 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles