KIAA0222

Product ID	ORK00467
Accession No	D86975
Description	zinc finger protein 516
Clone name	ha02586
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6033 bp) Predicted protein sequence (1204 aa)
HaloTag ORF Clone	FHC00467
Flexi ORF Clone	FXC00467
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0222 by Kazusa Mouse cDNA Project

Length: 6033 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2223 bp
Genome contig ID	gi51511735r_72101218
PolyA signal sequence (ATTAAA,-28)	+--------+--------+----*----+---- TTTAGTTATTAAAAAGAAATTCTGTACCCAAAGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACACGAAAGTGTAGTCTACATTTTTACTGTTTCAGAAGCGGCATGGAAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	18	r	72201218	72336134	7	99.0	Perfect prediction

Length: 1204 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001095926	0	97.0	zinc finger pro...	Macaca mulatta
Q92618	0	100.0	Zinc finger pro...	Homo sapiens
XP_225691	0	79.0	similar to zinc...	Rattus norvegicus
Q7TSH3	0	80.7	Zinc finger pro...	Mus musculus
EAW66579	2.5e-189	99.8	hCG14941, isofo...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002388	1.9e-19	38.3	KIAA0390

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	1139	1159	PD000003	Zinc finger
HMMPfam	IPR007087	75	97	PF00096	Zinc finger
	IPR007087	103	125	PF00096	Zinc finger
	IPR007087	289	311	PF00096	Zinc finger
	IPR007087	317	339	PF00096	Zinc finger
	IPR007087	1139	1161	PF00096	Zinc finger
HMMSmart	IPR015880	75	97	SM00355	Zinc finger
	IPR015880	103	125	SM00355	Zinc finger
	IPR015880	215	238	SM00355	Zinc finger
	IPR015880	241	264	SM00355	Zinc finger
	IPR015880	289	311	SM00355	Zinc finger
	IPR015880	317	339	SM00355	Zinc finger
	IPR015880	376	398	SM00355	Zinc finger
	IPR015880	556	578	SM00355	Zinc finger
	IPR015880	801	824	SM00355	Zinc finger
	IPR015880	1139	1161	SM00355	Zinc finger
ProfileScan	IPR007087	75	102	PS50157	Zinc finger
	IPR007087	103	125	PS50157	Zinc finger
	IPR007087	289	316	PS50157	Zinc finger
	IPR007087	317	344	PS50157	Zinc finger
	IPR007087	376	403	PS50157	Zinc finger
	IPR007087	556	583	PS50157	Zinc finger
	IPR007087	1139	1162	PS50157	Zinc finger
ScanRegExp	IPR007087	77	97	PS00028	Zinc finger
	IPR007087	217	238	PS00028	Zinc finger
	IPR007087	291	311	PS00028	Zinc finger
	IPR007087	319	339	PS00028	Zinc finger
	IPR007087	378	398	PS00028	Zinc finger
	IPR007087	558	578	PS00028	Zinc finger
	IPR007087	1141	1161	PS00028	Zinc finger

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CCACCTAAGAAATCAGAAGAC
Primer_r	TTCCTAACAGTCACCATTCAC
PCR product length	130 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles