KIAA0209

Product ID	ORK01964
Accession No	D86964
Description	dedicator of cytokinesis 2
Clone name	ha04649
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6050 bp) Predicted protein sequence (1842 aa)
HaloTag ORF Clone	FHC01964
Flexi ORF Clone	FXC01964
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0209 by Kazusa Mouse cDNA Project

Length: 6050 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	519 bp
Genome contig ID	gi51511721f_168896871
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTCTTACTGACAATAAAAAATGTTCTCTTGGTTCG
Flanking genome sequence (546090 - 546139)	----+--------+--------+--------+--------+----* AATAAGCCTTGTTGCCTGATTCTGTTGGCTGACTCTCCTGGGCCCAGGAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	168996871	169442959	52	99.8	Perfect prediction

Length: 1842 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92608	100.0	Dedicator of cy...	Homo sapiens
XP_527109	99.1	dedicator of cy...	Pan troglodytes
XP_001500151	95.7	dedicator of cy...	Equus caballus
CAI25210	95.1	dedicator of cy...	Mus musculus
Q8C3J5	95.0	Dedicator of cy...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002297	9.2e-101	38.7	KIAA0299
AB018259	8.6e-100	37.8	KIAA0716
AB037816	3e-06	24.4	KIAA1395

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	23	76	PD000066	Src homology-3
HMMPfam	IPR011511	24	78	PF07653	Variant SH3
HMMSmart	IPR001452	23	80	SM00326	Src homology-3
ProfileScan	IPR001452	20	81	PS50002	Src homology-3

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	AATCGGCTGAAGAAGGCAAAC
Primer_r	TCTCTGTCTCCTCTAAGTAAG
PCR product length	189 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles