KIAA0265

Product ID	ORK05587
Accession No	D87454
Description	kelch domain containing 10
Clone name	ha04704
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5551 bp) Predicted protein sequence (401 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0265 by Kazusa Mouse cDNA Project

Length: 5551 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4345 bp
Genome contig ID	gi89161213f_129397647
PolyA signal sequence (None)	+--------+--------+----*----+---- CATCTTTTTGGTGTAATTTTCATGTTTTTAATTTG
Flanking genome sequence (164522 - 164571)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAACAACTTTTTATAAGTTTTTTAAGGGCCCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	129497647	129562167	10	99.9	Perfect prediction

Length: 401 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001094651	3e-158	92.6	similar to scru...	Macaca mulatta
Q5U3Y0	3.7e-155	92.3	Kelch domain-co...	Rattus norvegicus
Q0IIC2	5.7e-154	89.4	Kelch domain-co...	Bos taurus
XP_001503006	5.7e-154	89.7	hypothetical pr...	Equus caballus
AAH44884	9.5e-153	89.0	Kelch domain co...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011106	1.4e-06	25.3	KIAA0534
AB037753	2.7e-06	26.4	KIAA1332
AB037730	1.9e-05	27.3	KIAA1309
AB037775	7.3e-05	25.5	KIAA1354
AB037805	0.0002	22.1	KIAA1384

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006652	50	107	PF01344	Kelch repeat type 1
	IPR011498	112	160	PF07646	Kelch repeat type 2
	IPR006652	165	210	PF01344	Kelch repeat type 1
	IPR006652	218	265	PF01344	Kelch repeat type 1
	IPR006652	274	319	PF01344	Kelch repeat type 1
HMMSmart	IPR006652	230	285	SM00612	Kelch repeat type 1
HMMSmart	IPR006652	286	333	SM00612	Kelch repeat type 1

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GGTCCTCTGATCATAAGCTCC
Primer_r	GAGGTCGCTTTTGGCTGAATC
PCR product length	210 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles