Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00472 |
---|---|
Accession No | D87074 |
Description | regulating synaptic membrane exocytosis 3 |
Clone name | ha06286 |
Vector information | |
cDNA sequence | DNA sequence (7239 bp) Predicted protein sequence (315 aa) |
HaloTag ORF Clone |
FHC00472
|
Flexi ORF Clone | FXC00472 |
Source | Human adult brain |
Rouge ID |
mKIAA0237
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 5837 bp |
---|---|
Genome contig ID | gi89161185r_40758939 |
PolyA signal sequence (ATTAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 40858939 | 40903919 | 8 | 99.1 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000008 | 178 | 265 | PF00168 | C2 calcium-dependent membrane targeting |
HMMSmart | IPR000008 | 177 | 280 | SM00239 | C2 calcium-dependent membrane targeting |
ProfileScan | IPR000008 | 175 | 265 | PS50004 | C2 calcium-dependent membrane targeting |
ScanRegExp | IPR001360 | 204 | 212 | PS00572 | Glycoside hydrolase |
Panel name | Genebridge 4 |
---|---|
Primer_f | ACTTGTTGTGGTTCCCGGGTG |
Primer_r | CTGCCCAAATACTGTACATGC |
PCR product length | 130 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |