KIAA1146

Product ID	ORK04186
Accession No	AB032972
Description	ankyrin repeat and SOCS box containing 1
Clone name	hg00368
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6518 bp) Predicted protein sequence (271 aa)
Source	Human adult brain
Rouge ID	mKIAA1146 by Kazusa Mouse cDNA Project

Length: 6518 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	5702 bp
Genome contig ID	gi89161199f_238909092
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- CGAATTAAATAAAGACATGCATCCATCTGTCAGCG
Flanking genome sequence (116539 - 116588)	----+--------+--------+--------+--------+----* ACTCCTTGTGTGTTCTGCCTCTTCATTCCTTGTCCCGGAACCTCTGCCAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	239009092	239025629	4	99.1	Perfect prediction

Length: 271 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9Y576	5.6e-122	100.0	Ankyrin repeat ...	Homo sapiens
XP_516189	7.4e-122	100.0	ankyrin repeat ...	Pan troglodytes
XP_001087304	4.6e-121	98.9	ankyrin repeat ...	Macaca mulatta
XP_874696	5.1e-117	96.3	similar to anky...	Bos taurus
XP_001496957	9.5e-117	95.9	similar to anky...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033049	2.6e-09	29.0	KIAA1223
AB007856	2.6e-08	36.0	KIAA0396
AB046856	7.9e-08	30.2	KIAA1636
AB014597	1.1e-07	37.2	KIAA0697
AB051515	1.8e-07	34.9	KIAA1728

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	14	26	PR01415	Ankyrin
FPrintScan	IPR002110	59	71	PR01415	Ankyrin
HMMPfam	IPR002110	15	45	PF00023	Ankyrin
	IPR002110	46	74	PF00023	Ankyrin
	IPR002110	79	111	PF00023	Ankyrin
	IPR002110	131	159	PF00023	Ankyrin
	IPR002110	176	204	PF00023	Ankyrin
	IPR001496	232	271	PF07525	SOCS protein
HMMSmart	IPR002110	13	42	SM00248	Ankyrin
	IPR002110	46	75	SM00248	Ankyrin
	IPR002110	79	108	SM00248	Ankyrin
	IPR002110	131	156	SM00248	Ankyrin
ProfileScan	IPR002110	16	45	PS50088	Ankyrin
	IPR002110	16	159	PS50297	Ankyrin
	IPR002110	46	78	PS50088	Ankyrin
	IPR002110	79	111	PS50088	Ankyrin
	IPR001496	229	271	PS50225	SOCS protein

Primer_f	TTCATTCCAGGTTCATCCCAC
Primer_r	TGATGGAGACTGTGGGCAAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGATGGAGACTGTGGGCAAGC
Primer_r	TTCATTCCAGGTTCATCCCAC
PCR product length	110 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles