Gene/Protein Characteristic Table for KIAA0326
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00506
Accession No AB002324
Description zinc finger protein 629
Clone name hg00579
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6045 bp)
Predicted protein sequence (927 aa)
Flexi ORF Clone FXC00506
Source Human adult brain
Rouge ID mKIAA0326 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6045 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 927 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9UEG4 0 100.0 Zinc finger pro...
Homo sapiens
XP_523345 0 98.6 zinc finger pro...
Pan troglodytes
XP_001102645 0 94.4 similar to zinc...
Macaca mulatta
XP_547033 0 89.0 similar to zinc...
Canis lupus fam...
XP_001915135 0 93.3 zinc finger pro...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB037770 1.1e-56 44.7 KIAA1349
AB075836 1.5e-56 49.4 KIAA1956
AB046831 7.9e-56 44.2 KIAA1611
D31763 2.4e-54 52.6 KIAA0065
AB018341 4.5e-53 51.5 KIAA0798
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 208 231 PD000003 Zinc finger
IPR007087 238 259 PD000003 Zinc finger
IPR007087 264 287 PD000003 Zinc finger
IPR007087 292 315 PD000003 Zinc finger
IPR007087 320 343 PD000003 Zinc finger
IPR007087 348 370 PD000003 Zinc finger
IPR007087 376 399 PD000003 Zinc finger
IPR007087 404 426 PD000003 Zinc finger
IPR007087 432 455 PD000003 Zinc finger
IPR007087 460 482 PD000003 Zinc finger
IPR007087 488 511 PD000003 Zinc finger
IPR007087 516 539 PD000003 Zinc finger
IPR007087 544 566 PD000003 Zinc finger
HMMPfam IPR007087 208 230 PF00096 Zinc finger
IPR007087 236 258 PF00096 Zinc finger
IPR007087 264 286 PF00096 Zinc finger
IPR007087 292 314 PF00096 Zinc finger
IPR007087 320 342 PF00096 Zinc finger
IPR007087 348 370 PF00096 Zinc finger
IPR007087 376 398 PF00096 Zinc finger
IPR007087 404 426 PF00096 Zinc finger
IPR007087 432 454 PF00096 Zinc finger
IPR007087 460 482 PF00096 Zinc finger
IPR007087 488 510 PF00096 Zinc finger
IPR007087 516 538 PF00096 Zinc finger
IPR007087 544 566 PF00096 Zinc finger
IPR007087 572 594 PF00096 Zinc finger
IPR007087 627 649 PF00096 Zinc finger
IPR007087 720 742 PF00096 Zinc finger
IPR007087 772 794 PF00096 Zinc finger
IPR007087 826 848 PF00096 Zinc finger
HMMSmart IPR015880 208 230 SM00355 Zinc finger
IPR015880 236 258 SM00355 Zinc finger
IPR015880 264 286 SM00355 Zinc finger
IPR015880 292 314 SM00355 Zinc finger
IPR015880 320 342 SM00355 Zinc finger
IPR015880 348 370 SM00355 Zinc finger
IPR015880 376 398 SM00355 Zinc finger
IPR015880 404 426 SM00355 Zinc finger
IPR015880 432 454 SM00355 Zinc finger
IPR015880 460 482 SM00355 Zinc finger
IPR015880 488 510 SM00355 Zinc finger
IPR015880 516 538 SM00355 Zinc finger
IPR015880 544 566 SM00355 Zinc finger
IPR015880 572 594 SM00355 Zinc finger
IPR015880 627 649 SM00355 Zinc finger
IPR015880 720 742 SM00355 Zinc finger
IPR015880 772 794 SM00355 Zinc finger
IPR015880 826 848 SM00355 Zinc finger
IPR015880 900 922 SM00355 Zinc finger
ProfileScan IPR007087 208 235 PS50157 Zinc finger
IPR007087 236 263 PS50157 Zinc finger
IPR007087 264 291 PS50157 Zinc finger
IPR007087 292 319 PS50157 Zinc finger
IPR007087 320 347 PS50157 Zinc finger
IPR007087 348 375 PS50157 Zinc finger
IPR007087 376 403 PS50157 Zinc finger
IPR007087 404 431 PS50157 Zinc finger
IPR007087 432 459 PS50157 Zinc finger
IPR007087 460 487 PS50157 Zinc finger
IPR007087 488 515 PS50157 Zinc finger
IPR007087 516 543 PS50157 Zinc finger
IPR007087 544 571 PS50157 Zinc finger
IPR007087 572 599 PS50157 Zinc finger
IPR007087 627 654 PS50157 Zinc finger
IPR007087 720 747 PS50157 Zinc finger
IPR007087 772 799 PS50157 Zinc finger
IPR007087 826 853 PS50157 Zinc finger
IPR007087 900 924 PS50157 Zinc finger
ScanRegExp IPR007087 210 230 PS00028 Zinc finger
IPR007087 238 258 PS00028 Zinc finger
IPR007087 266 286 PS00028 Zinc finger
IPR007087 294 314 PS00028 Zinc finger
IPR007087 322 342 PS00028 Zinc finger
IPR007087 350 370 PS00028 Zinc finger
IPR007087 378 398 PS00028 Zinc finger
IPR007087 406 426 PS00028 Zinc finger
IPR007087 434 454 PS00028 Zinc finger
IPR007087 462 482 PS00028 Zinc finger
IPR007087 490 510 PS00028 Zinc finger
IPR007087 518 538 PS00028 Zinc finger
IPR007087 546 566 PS00028 Zinc finger
IPR007087 574 594 PS00028 Zinc finger
IPR007087 629 649 PS00028 Zinc finger
IPR007087 722 742 PS00028 Zinc finger
IPR007087 774 794 PS00028 Zinc finger
IPR007087 828 848 PS00028 Zinc finger
IPR007087 902 922 PS00028 Zinc finger
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f ACTAAGCAACATGACCACCAG
Primer_r AGACTCCTTTGCCCTCACTAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 16
Experimental conditions
Panel name GeneBridge 4
Primer_f ACTAAGCAACATGACCACCAG
Primer_r AGACTCCTTTGCCCTCACTAG
PCR product length 128 bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp