Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01666 |
---|---|
Accession No | AB007867 |
Description | plexin B1, transcript variant 1 |
Clone name | hg01339 |
Vector information | |
cDNA sequence | DNA sequence (7308 bp) Predicted protein sequence (2143 aa) |
HaloTag ORF Clone |
FHC01666
|
Flexi ORF Clone | FXC01666 |
Source | Human adult brain |
Rouge ID |
mKIAA0407
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001627 | 43 | 470 | PF01403 | Semaphorin/CD100 antigen |
IPR002165 | 489 | 542 | PF01437 | Plexin | |
IPR002165 | 1029 | 1076 | PF01437 | Plexin | |
IPR002909 | 1078 | 1167 | PF01833 | Cell surface receptor IPT/TIG | |
IPR002909 | 1170 | 1256 | PF01833 | Cell surface receptor IPT/TIG | |
IPR002909 | 1260 | 1382 | PF01833 | Cell surface receptor IPT/TIG | |
IPR013548 | 1569 | 2110 | PF08337 | Plexin cytoplasmic region | |
HMMSmart | IPR001627 | 43 | 471 | SM00630 | Semaphorin/CD100 antigen |
IPR003659 | 489 | 542 | SM00423 | Plexin/semaphorin/integrin | |
IPR003659 | 636 | 686 | SM00423 | Plexin/semaphorin/integrin | |
IPR003659 | 1029 | 1076 | SM00423 | Plexin/semaphorin/integrin | |
IPR002909 | 1077 | 1168 | SM00429 | Cell surface receptor IPT/TIG | |
IPR002909 | 1169 | 1257 | SM00429 | Cell surface receptor IPT/TIG | |
IPR002909 | 1259 | 1383 | SM00429 | Cell surface receptor IPT/TIG | |
ProfileScan | IPR001627 | 17 | 487 | PS51004 | Semaphorin/CD100 antigen |
ScanRegExp | IPR003006 | 1028 | 1034 | PS00290 | Immunoglobulin/major histocompatibility complex motif |
IPR002345 | 1829 | 1841 | PS00213 | Lipocalin |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 7 | VTMPALGPALLQALWAGWVLTLQ | 29 | SECONDARY | 23 | 2 | 1494 | PVAAQVGLGVGTSLLALGVIIIV | 1516 | PRIMARY | 23 |
---|
RT-PCR |
---|
Primer_f | AAAAGCTGGGTCAATGGAGTC |
---|---|
Primer_r | TTGCTGCTGCCACATCCTAGG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AAAAGCTGGGTCAATGGAGTC |
Primer_r | TTGCTGCTGCCACATCCTAGG |
PCR product length | 176 bp |
PCR conditions | 95 °C15 sec66 °C60 sec30 cycles |