KIAA0344

Product ID	ORK07367
Accession No	AB002342
Description	WNK lysine deficient protein kinase 1
Clone name	hg01568
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6812 bp) Predicted protein sequence (2066 aa)
Source	Human adult brain
Rouge ID	mKIAA0344 by Kazusa Mouse cDNA Project
Note	We replaced hg01486, former representative clones for KIAA0344 with hg01568. (2002/5/10)

Length: 6812 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	609 bp
Genome contig ID	gi89161190f_633195
PolyA signal sequence (None)	+--------+--------+----*----+---- CAAAAGATATTAGCAGCTTTGACTGCAGCATTAGC
Flanking genome sequence (255635 - 255684)	----+--------+--------+--------+--------+----* AATTAGGAAAAAAAAAAAATTAAGTTCCCTGCGGACATGTAACTTTGCCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	733195	888828	26	99.6	Perfect prediction

Length: 2066 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001150489	99.0	WNK lysine defi...	Pan troglodytes
XP_001095637	96.8	similar to WNK ...	Macaca mulatta
EAW88958	99.9	WNK lysine defi...	Homo sapiens
AAS45192	85.4	protein kinase ...	Mus musculus
AAI38446	85.4	Wnk1 protein [M...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051547	2.2e-46	33.9	KIAA1760
AB046786	4.8e-06	27.0	KIAA1566
AB058763	5.3e-05	22.7	KIAA1860
AB033104	5.4e-05	26.7	KIAA1278
AB067488	8.5e-05	20.9	KIAA1901

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	159	411	PD000001	Protein kinase
HMMPfam	IPR000719	153	411	PF00069	Protein kinase
HMMSmart	IPR001245	153	411	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	153	411	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	153	411	PS50011	Protein kinase
ScanRegExp	IPR008271	277	289	PS00108	Serine/threonine protein kinase

Primer_f	ACCATATCCACTCTCTGTCAC
Primer_r	TGTTTCACGCAGTCCATTTTC
PCR conditions	95 °C30 sec61 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ACCATATCCACTCTCTGTCAC
Primer_r	TGTTTCACGCAGTCCATTTTC
PCR product length	206 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles