Gene/Protein Characteristic Table for KIAA0354
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00058
Accession No AB002352
Description zinc finger and BTB domain containing 5
Clone name hg01842
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4631 bp)
Predicted protein sequence (730 aa)
Flexi ORF Clone FXC00058
Source Human adult brain
Rouge ID mKIAA0354 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4631 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 730 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_538734 0 95.5 similar to Zinc...
Canis lupus fam...
O15062 0 100.0 Zinc finger and...
Homo sapiens
XP_001504333 0 96.8 similar to Zinc...
Equus caballus
AAI26575 0 95.3 Zinc finger and...
Bos taurus
EDL98801 0 93.1 zinc finger and...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB023214 1.6e-05 20.8 KIAA0997
AB028943 2.6e-05 22.9 KIAA1020
AB033053 0.0001 23.3 KIAA1227
AB007874 0.00023 24.2 KIAA0414
AB075831 0.0004 33.3 KIAA1951
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR013069 67 176 PF00651 BTB/POZ
IPR007087 694 717 PF00096 Zinc finger
HMMSmart IPR000210 77 176 SM00225 BTB/POZ-like
IPR015880 666 688 SM00355 Zinc finger
IPR015880 694 714 SM00355 Zinc finger
ProfileScan IPR000210 77 146 PS50097 BTB/POZ-like
IPR007087 666 693 PS50157 Zinc finger
IPR007087 694 726 PS50157 Zinc finger
ScanRegExp IPR007087 668 688 PS00028 Zinc finger
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f AAGTTGTAACCAGCATAGCAC
Primer_r TTATAGTCTGGCGTGATCATG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 9
Experimental conditions
Panel name GeneBridge 4
Primer_f AAGTTGTAACCAGCATAGCAC
Primer_r TTATAGTCTGGCGTGATCATG
PCR product length 112 bp
PCR conditions 95 °C15 sec60 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp