Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00518 |
---|---|
Accession No | AB002362 |
Description | immunoglobulin superfamily, member 1, transcript variant 4 |
Clone name | hh00116 |
Vector information | |
cDNA sequence | DNA sequence (5413 bp) Predicted protein sequence (1437 aa) |
HaloTag ORF Clone |
FHC00518
|
Flexi ORF Clone | FXC00518 |
Source | Human adult brain |
Rouge ID |
mKIAA0364
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 285 bp |
---|---|
Genome contig ID | gi89161218r_130135166 |
PolyA signal sequence (AATAAA,-29) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013151 | 437 | 495 | PF00047 | Immunoglobulin |
IPR013151 | 535 | 587 | PF00047 | Immunoglobulin | |
IPR013151 | 797 | 853 | PF00047 | Immunoglobulin | |
IPR013151 | 893 | 952 | PF00047 | Immunoglobulin | |
IPR013151 | 989 | 1045 | PF00047 | Immunoglobulin | |
IPR013151 | 1181 | 1237 | PF00047 | Immunoglobulin | |
HMMSmart | IPR003599 | 144 | 224 | SM00409 | Immunoglobulin subtype |
IPR003599 | 238 | 323 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 244 | 307 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 334 | 418 | SM00409 | Immunoglobulin subtype | |
IPR003599 | 429 | 516 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 435 | 500 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 527 | 600 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 533 | 592 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 789 | 874 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 795 | 858 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 885 | 970 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 891 | 959 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 981 | 1066 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 987 | 1051 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 1077 | 1162 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 1083 | 1146 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 1173 | 1258 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 1179 | 1242 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 1269 | 1348 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 1275 | 1334 | SM00408 | Immunoglobulin subtype 2 | |
ProfileScan | IPR007110 | 139 | 207 | PS50835 | Immunoglobulin-like |
IPR007110 | 422 | 493 | PS50835 | Immunoglobulin-like | |
IPR007110 | 520 | 585 | PS50835 | Immunoglobulin-like | |
IPR007110 | 878 | 970 | PS50835 | Immunoglobulin-like | |
IPR007110 | 974 | 1043 | PS50835 | Immunoglobulin-like | |
IPR007110 | 1166 | 1235 | PS50835 | Immunoglobulin-like |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 620 | EAIRLSLIMQLVALLLVVLWIR | 641 | PRIMARY | 22 | 2 | 662 | TMLFIVTALLCCGLCNGVLIEE | 683 | PRIMARY | 22 | 3 | 1363 | IVRSSLIVVVVVALGVVLAIEW | 1384 | PRIMARY | 22 |
---|
RT-PCR |
---|
Primer_f | TACAGTGAGGAGTTACAGGGG |
---|---|
Primer_r | GCTGTTCCTTGGTCTCTAATC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TACAGTGAGGAGTTACAGGGG |
Primer_r | GCTGTTCCTTGGTCTCTAATC |
PCR product length | 119 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |