Gene/Protein Characteristic Table for KIAA1132
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00183
Accession No AB032958
Description Down syndrome cell adhesion molecule like 1
Clone name hh01132s1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6834 bp)
Predicted protein sequence (2092 aa)
Flexi ORF Clone FXC00183
Source Human adult brain
Rouge ID mKIAA1132 by Kazusa Mouse cDNA Project
Note We replaced hh01132, former representative clones for KIAA1132 with hh01132s1. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 6834 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 555 bp
Genome contig ID gi51511727r_116703699
PolyA signal sequence
(AATAAA,-18)		 
+----*----+----*----+----*----+----
GACCCAGCGCCGTGTGCAATAAAGGTTATGTTTCT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
ATGTGGTGGCTTTTTTCCCATCTGGCGAAGGCCAGCGGGGAGGGAGGAGA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 11 r 116803699 117173121 33 99.8 Perfect prediction
Features of the protein sequence
Description

Length: 2092 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAM09558 0 100.0 Down syndrome c...
 Homo sapiens
XP_001158737 0 99.8 Down syndrome c...
 Pan troglodytes
NP_001074739 0 98.2 Down syndrome c...
 Mus musculus
EDL95372 0 98.1 Down syndrome c...
 Rattus norvegicus
AAL57166 0 100.0 Down syndrome c...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB040929 2.9e-12 24.8 KIAA1496
AB046788 2.4e-10 27.5 KIAA1568
AB018299 5.6e-09 24.2 KIAA0756
AB040947 4.4e-06 27.2 KIAA1514
AB037776 4.3e-05 23.7 KIAA1355
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR013098 265 350 PF07679 Immunoglobulin I-set
IPR013151 368 427 PF00047 Immunoglobulin
IPR013098 447 541 PF07679 Immunoglobulin I-set
IPR013151 558 616 PF00047 Immunoglobulin
IPR013151 649 710 PF00047 Immunoglobulin
IPR013098 729 824 PF07679 Immunoglobulin I-set
IPR013151 842 908 PF00047 Immunoglobulin
IPR003961 926 1013 PF00041 Fibronectin
IPR003961 1025 1117 PF00041 Fibronectin
IPR003961 1129 1218 PF00041 Fibronectin
IPR003961 1230 1316 PF00041 Fibronectin
IPR013098 1329 1419 PF07679 Immunoglobulin I-set
IPR003961 1423 1506 PF00041 Fibronectin
IPR003961 1520 1602 PF00041 Fibronectin
HMMSmart IPR003599 71 161 SM00409 Immunoglobulin subtype
IPR003598 77 149 SM00408 Immunoglobulin subtype 2
IPR003599 170 258 SM00409 Immunoglobulin subtype
IPR003599 271 351 SM00409 Immunoglobulin subtype
IPR003598 277 340 SM00408 Immunoglobulin subtype 2
IPR003596 281 335 SM00406 Immunoglobulin V-set
IPR003599 360 442 SM00409 Immunoglobulin subtype
IPR003598 366 432 SM00408 Immunoglobulin subtype 2
IPR003599 453 542 SM00409 Immunoglobulin subtype
IPR003598 459 531 SM00408 Immunoglobulin subtype 2
IPR003599 550 633 SM00409 Immunoglobulin subtype
IPR003598 556 621 SM00408 Immunoglobulin subtype 2
IPR003599 641 726 SM00409 Immunoglobulin subtype
IPR003598 647 715 SM00408 Immunoglobulin subtype 2
IPR003599 735 825 SM00409 Immunoglobulin subtype
IPR003598 741 813 SM00408 Immunoglobulin subtype 2
IPR003599 834 924 SM00409 Immunoglobulin subtype
IPR003598 840 913 SM00408 Immunoglobulin subtype 2
IPR003961 926 1010 SM00060 Fibronectin
IPR003961 1026 1114 SM00060 Fibronectin
IPR003961 1129 1215 SM00060 Fibronectin
IPR003961 1230 1313 SM00060 Fibronectin
IPR003599 1338 1420 SM00409 Immunoglobulin subtype
IPR003598 1344 1409 SM00408 Immunoglobulin subtype 2
IPR003596 1345 1404 SM00406 Immunoglobulin V-set
IPR003961 1423 1503 SM00060 Fibronectin
IPR003961 1518 1599 SM00060 Fibronectin
ProfileScan IPR007110 57 146 PS50835 Immunoglobulin-like
IPR007110 154 256 PS50835 Immunoglobulin-like
IPR007110 265 345 PS50835 Immunoglobulin-like
IPR007110 353 441 PS50835 Immunoglobulin-like
IPR007110 447 540 PS50835 Immunoglobulin-like
IPR007110 545 625 PS50835 Immunoglobulin-like
IPR007110 635 724 PS50835 Immunoglobulin-like
IPR007110 729 823 PS50835 Immunoglobulin-like
IPR007110 827 924 PS50835 Immunoglobulin-like
IPR003961 926 1019 PS50853 Fibronectin
IPR003961 1025 1124 PS50853 Fibronectin
IPR003961 1129 1225 PS50853 Fibronectin
IPR003961 1230 1322 PS50853 Fibronectin
IPR007110 1317 1416 PS50835 Immunoglobulin-like
IPR003961 1419 1513 PS50853 Fibronectin
IPR003961 1518 1608 PS50853 Fibronectin

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 34 IGPLYGMWLVTFLLLLDSLHK 54 SECONDARY 21
2 1631 LFTIGCPVILATLGVALLFIV 1651 PRIMARY 21
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CCAAAATCCCAACTCAGAGAC
Primer_r AACCTTTATTGCACACGGCGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 11
Experimental conditions
Panel name GeneBridge 4
Primer_f TCAAGAAGTTCGCCCAGTATG
Primer_r TTGAGGACGCCATTGAGGGTG
PCR product length 205(3.0k) bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp