KIAA1108

Product ID	ORK07061
Accession No	AB029031
Description	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1
Clone name	hh03387s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326GW (Amp-r) vector. The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. The original pYO326 shuttle vector (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (2576 bp) Predicted protein sequence (763 aa)
Source	Human adult brain
Rouge ID	mKIAA1108 by Kazusa Mouse cDNA Project
Note	We replaced hh03387, former representative clones for KIAA1108 with hh03387s1. (2002/5/10)

Length: 2576 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	284 bp
Genome contig ID	gi89161207f_37605809
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ATGGCGTGGACGTGAATAAATGCAACTTATGTTTT
Flanking genome sequence (209828 - 209877)	----+--------+--------+--------+--------+----* CTTGTTGGTTCCTTTTTGAGTGTCACTGTGTTTGTAAAGAGCATTCACAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	37705809	37815635	14	100.0	Perfect prediction

Length: 763 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH53648	100.0	TBC1D1 protein ...	Homo sapiens
AAH14529	100.0	TBC1D1 protein ...	Homo sapiens
EAW92889	100.0	hCG39018 [Homo ...	Homo sapiens
Q86TI0	100.0	TBC1 domain fam...	Homo sapiens
AAH50321	99.9	TBC1 (tre-2/USP...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011175	3.5e-82	52.3	KIAA0603
D13644	4.3e-13	26.9	KIAA0019
AB028978	1.1e-10	24.7	KIAA1055
AB020689	1.9e-10	27.4	KIAA0882
AB014576	6.3e-09	24.0	KIAA0676

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000195	392	611	PF00566	RabGAP/TBC
HMMSmart	IPR000195	392	612	SM00164	RabGAP/TBC
ProfileScan	IPR000195	395	589	PS50086	RabGAP/TBC
ScanRegExp	IPR001220	121	127	PS00307	Legume lectin

Primer_f	CTCCAACTTGCAATTCAGGGG
Primer_r	GCATTTATTCACGTCCACGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-