KIAA1959

Product ID	ORK00956
Accession No	AB075839
Description	ubiquitin associated and SH3 domain containing B
Clone name	hh03965
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4722 bp) Predicted protein sequence (650 aa)
HaloTag ORF Clone	FHC00956
Flexi ORF Clone	FXC00956
Source	Human adult brain
Rouge ID	mKIAA1959 by Kazusa Mouse cDNA Project

Length: 4722 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	2560 bp
Genome contig ID	gi51511727f_121931756
PolyA signal sequence (None)	+--------+--------+----*----+---- TACTCAATTTCATATACATCCAAAAAGTATAGGCT
Flanking genome sequence (256609 - 256658)	----+--------+--------+--------+--------+----* AATATATATAACCTGAAGTTGCAGCTGGTTCTTTTTGATCTGAAGCTGAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	122031756	122188363	14	99.4	Perfect prediction

Length: 650 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8TF42	100.0	Ubiquitin assoc...	Homo sapiens
XP_508828	99.8	Cbl-interacting...	Pan troglodytes
XP_001107573	99.5	similar to Cbl-...	Macaca mulatta
BAD96563	99.7	Cbl-interacting...	Homo sapiens
XP_001917603	98.5	similar to Ubiq...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037717	0.00024	45.6	KIAA1296
AB018320	0.00055	38.0	KIAA0777
AB040927	0.00085	28.3	KIAA1494

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	261	315	PD000066	Src homology-3
HMMPfam	IPR000449	37	77	PF00627	Ubiquitin-associated/Translation elongation factor EF1B
	IPR001452	258	318	PF00018	Src homology-3
	IPR013078	386	584	PF00300	Phosphoglycerate mutase
HMMSmart	IPR000449	38	76	SM00165	Ubiquitin-associated/Translation elongation factor EF1B
HMMSmart	IPR001452	258	319	SM00326	Src homology-3
ProfileScan	IPR000449	28	77	PS50030	Ubiquitin-associated/Translation elongation factor EF1B
ProfileScan	IPR001452	255	320	PS50002	Src homology-3

Primer_f	AGACCTCACATTCCAATCAGC
Primer_r	ATTTGTACGAAGTCCTTGGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-