Order Kazusa clone(s) from : ![]() |
Product ID | ORK00956 |
---|---|
Accession No | AB075839 |
Description | ubiquitin associated and SH3 domain containing B |
Clone name | hh03965 |
Vector information | |
cDNA sequence | DNA sequence (4722 bp) Predicted protein sequence (650 aa) |
HaloTag ORF Clone |
FHC00956
![]() |
Flexi ORF Clone | FXC00956 |
Source | Human adult brain |
Rouge ID |
mKIAA1959
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 2560 bp |
---|---|
Genome contig ID | gi51511727f_121931756 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (256609 - 256658) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | f | 122031756 | 122188363 | 14 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001452 | 261 | 315 | PD000066 | Src homology-3 |
HMMPfam | IPR000449 | 37 | 77 | PF00627 | Ubiquitin-associated/Translation elongation factor EF1B |
IPR001452 | 258 | 318 | PF00018 | Src homology-3 | |
IPR013078 | 386 | 584 | PF00300 | Phosphoglycerate mutase | |
HMMSmart | IPR000449 | 38 | 76 | SM00165 | Ubiquitin-associated/Translation elongation factor EF1B |
IPR001452 | 258 | 319 | SM00326 | Src homology-3 | |
ProfileScan | IPR000449 | 28 | 77 | PS50030 | Ubiquitin-associated/Translation elongation factor EF1B |
IPR001452 | 255 | 320 | PS50002 | Src homology-3 |
![]() |
Primer_f | AGACCTCACATTCCAATCAGC |
---|---|
Primer_r | ATTTGTACGAAGTCCTTGGAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |