KIAA0829

Product ID	ORK01125
Accession No	AB020636
Description	cullin-associated and neddylation-dissociated 1
Clone name	hh04834s1
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5813 bp) Predicted protein sequence (1277 aa)
HaloTag ORF Clone	FHC01125
Flexi ORF Clone	FXC01125
Source	Human adult brain
Rouge ID	mKIAA0829 by Kazusa Mouse cDNA Project
Note	We replaced hh04834, former representative clones for KIAA0829 with hh04834s1. (2005/08/06)

Length: 5813 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1781 bp
Genome contig ID	gi89161190f_65849426
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- ATGGTTTTACAATAAATTACAATACTGCAGGCTCT
Flanking genome sequence (145234 - 145283)	----+--------+--------+--------+--------+----* AGGACTGAACAGGAGACTGACATGCATATGTTGTGTGAATGTCTTAGTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	65949426	65994658	15	99.7	Perfect prediction

Length: 1277 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_509204	99.5	TIP120 protein ...	Pan troglodytes
XP_001106780	99.6	similar to TIP1...	Macaca mulatta
Q86VP6	100.0	Cullin-associat...	Homo sapiens
AAH50341	99.9	Cullin-associat...	Homo sapiens
BAF85145	99.9	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014567	4.3e-164	55.2	KIAA0667

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	90	126	PF02985	HEAT
	IPR000357	217	253	PF02985	HEAT
	IPR000357	297	333	PF02985	HEAT
	IPR000357	899	934	PF02985	HEAT
	IPR000357	1048	1084	PF02985	HEAT
	IPR013932	1086	1252	PF08623	TATA-binding protein interacting (TIP20)

Primer_f	TCTCAGTTACCCATTTGTGTG
Primer_r	AAACCTGTGATAGCTGGCTTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-