KIAA1436

Product ID	ORK01630
Accession No	AB037857
Description	prostaglandin F2 receptor inhibitor
Clone name	hh15451
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6160 bp) Predicted protein sequence (924 aa)
HaloTag ORF Clone	FHC01630
Flexi ORF Clone	FXC01630
Source	Human adult brain
Rouge ID	mKIAA1436 by Kazusa Mouse cDNA Project

Length: 6160 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3383 bp
Genome contig ID	gi89161185f_117154212
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- ATTTGTTTTTTATTTCATTAAAGGAAGTTTAATTT
Flanking genome sequence (180285 - 180334)	----+--------+--------+--------+--------+----* AAATTGAAGTTGTGTGAGGAGCTTGATATTGGCCTCTGTCCTTTCATATC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	117254212	117334495	9	99.9	Perfect prediction

Length: 924 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001103382	98.5	prostaglandin F...	Macaca mulatta
Q9P2B2	100.0	Prostaglandin F...	Homo sapiens
BAC11104	99.8	unnamed protein...	Homo sapiens
CAI26224	90.0	prostaglandin F...	Mus musculus
EDL07630	90.1	prostaglandin F...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007935	1.8e-37	26.3	KIAA0466

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013106	66	186	PF07686	Immunoglobulin V-set
	IPR013151	207	294	PF00047	Immunoglobulin
	IPR013106	321	421	PF07686	Immunoglobulin V-set
	IPR013151	467	562	PF00047	Immunoglobulin
HMMSmart	IPR003599	73	186	SM00409	Immunoglobulin subtype
	IPR003596	83	166	SM00406	Immunoglobulin V-set
	IPR003599	199	315	SM00409	Immunoglobulin subtype
	IPR003599	329	435	SM00409	Immunoglobulin subtype
	IPR003596	339	420	SM00406	Immunoglobulin V-set
	IPR003599	459	577	SM00409	Immunoglobulin subtype
	IPR003596	469	562	SM00406	Immunoglobulin V-set
	IPR003599	601	721	SM00409	Immunoglobulin subtype
	IPR003599	741	867	SM00409	Immunoglobulin subtype
ProfileScan	IPR007110	53	174	PS50835	Immunoglobulin-like
	IPR007110	194	313	PS50835	Immunoglobulin-like
	IPR007110	321	439	PS50835	Immunoglobulin-like
	IPR007110	451	581	PS50835	Immunoglobulin-like
	IPR007110	733	858	PS50835	Immunoglobulin-like

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	878	LLIGVGLSTVIGLLSCLIGYCSS	900	PRIMARY	23

Primer_f	TCAGGATTTTATTGGCACAGG
Primer_r	TCAATGCCTTAACAACTCCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-