Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00617 |
---|---|
Accession No | AB018278 |
Description | synaptic vesicle glycoprotein 2B, transcript variant 1 |
Clone name | hj00943 |
Vector information | |
cDNA sequence | DNA sequence (4948 bp) Predicted protein sequence (707 aa) |
HaloTag ORF Clone |
FHC00617
|
Flexi ORF Clone | FXC00617 |
Source | Human adult brain |
Rouge ID |
mKIAA0735
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2732 bp |
---|---|
Genome contig ID | gi51511731f_89470349 |
PolyA signal sequence (ATTAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (169171 - 169220) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | f | 89570334 | 89639518 | 12 | 99.4 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR011701 | 139 | 674 | PF07690 | Major facilitator superfamily MFS_1 |
HMMTigr | IPR005988 | 1 | 707 | TIGR01299 | Synaptic vesicle protein SV2 |
ProfileScan | IPR007114 | 135 | 702 | PS50850 | Major facilitator superfamily |
ScanRegExp | IPR005829 | 189 | 205 | PS00216 | Sugar transporter superfamily |
IPR005829 | 231 | 256 | PS00217 | Sugar transporter superfamily |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 134 | ILFFVLGLALMADGVEVFVVSFA | 156 | PRIMARY | 23 | 2 | 173 | MLGMIVYLGMMAGAFILGGLADK | 195 | PRIMARY | 23 | 3 | 229 | RLISGIGIGGALPIVFAYFSEFL | 251 | PRIMARY | 23 | 4 | 261 | SWLGIFWMTGGLYASAMAWSIIP | 283 | SECONDARY | 23 | 5 | 300 | WRVFVIVCALPCTVSMVALKFMP | 322 | PRIMARY | 23 | 6 | 416 | ILAVVWFAMAFSYYGLTVWFPDM | 438 | PRIMARY | 23 | 7 | 561 | LIYLVSFLGSLSVLPGNIISALL | 583 | SECONDARY | 23 | 8 | 591 | KMIGGSMLISAVCCFFLFF | 609 | PRIMARY | 19 | 9 | 619 | WQCLFCGTSIAAWNALDVITVEL | 641 | SECONDARY | 23 | 10 | 649 | TAFGILNGLCKFGAILGNTIFAS | 671 | SECONDARY | 23 | 11 | 681 | ILLAAASLVGGGLIALRLPETRE | 703 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | TCTTAAATGCCGTCACTCCTG |
---|---|
Primer_r | AGTGAAAAAGAAGTGGATGGC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTACCCTTCCACACAATAGCC |
Primer_r | AAAACTACAACACGTCACAGC |
PCR product length | 110 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |