Order Kazusa clone(s) from : ![]() |
Product ID | ORK00617 |
---|---|
Accession No | AB018278 |
Description | synaptic vesicle glycoprotein 2B, transcript variant 1 |
Clone name | hj00943 |
Vector information | |
cDNA sequence | DNA sequence (4948 bp) Predicted protein sequence (707 aa) |
HaloTag ORF Clone |
FHC00617
![]() |
Flexi ORF Clone | FXC00617 |
Source | Human adult brain |
Rouge ID |
mKIAA0735
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2732 bp |
---|---|
Genome contig ID | gi51511731f_89470349 |
PolyA signal sequence (ATTAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (169171 - 169220) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | f | 89570334 | 89639518 | 12 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR011701 | 139 | 674 | PF07690 | Major facilitator superfamily MFS_1 |
HMMTigr | IPR005988 | 1 | 707 | TIGR01299 | Synaptic vesicle protein SV2 |
ProfileScan | IPR007114 | 135 | 702 | PS50850 | Major facilitator superfamily |
ScanRegExp | IPR005829 | 189 | 205 | PS00216 | Sugar transporter superfamily |
IPR005829 | 231 | 256 | PS00217 | Sugar transporter superfamily |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 134 | ILFFVLGLALMADGVEVFVVSFA | 156 | PRIMARY | 23 | 2 | 173 | MLGMIVYLGMMAGAFILGGLADK | 195 | PRIMARY | 23 | 3 | 229 | RLISGIGIGGALPIVFAYFSEFL | 251 | PRIMARY | 23 | 4 | 261 | SWLGIFWMTGGLYASAMAWSIIP | 283 | SECONDARY | 23 | 5 | 300 | WRVFVIVCALPCTVSMVALKFMP | 322 | PRIMARY | 23 | 6 | 416 | ILAVVWFAMAFSYYGLTVWFPDM | 438 | PRIMARY | 23 | 7 | 561 | LIYLVSFLGSLSVLPGNIISALL | 583 | SECONDARY | 23 | 8 | 591 | KMIGGSMLISAVCCFFLFF | 609 | PRIMARY | 19 | 9 | 619 | WQCLFCGTSIAAWNALDVITVEL | 641 | SECONDARY | 23 | 10 | 649 | TAFGILNGLCKFGAILGNTIFAS | 671 | SECONDARY | 23 | 11 | 681 | ILLAAASLVGGGLIALRLPETRE | 703 | PRIMARY | 23 |
---|
![]() |
Primer_f | TCTTAAATGCCGTCACTCCTG |
---|---|
Primer_r | AGTGAAAAAGAAGTGGATGGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTACCCTTCCACACAATAGCC |
Primer_r | AAAACTACAACACGTCACAGC |
PCR product length | 110 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |