Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK07033 |
---|---|
Accession No | AB028977 |
Description | synaptic vesicle glycoprotein 2C |
Clone name | hh05240 |
Vector information | |
cDNA sequence | DNA sequence (5962 bp) Predicted protein sequence (480 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1054
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 4517 bp |
---|---|
Genome contig ID | gi51511721f_75441316 |
PolyA signal sequence (AGTAAA,-33) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (220331 - 220380) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | f | 75526659 | 75661645 | 11 | 99.2 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR005828 | 1 | 114 | PF00083 | General substrate transporter |
IPR011701 | 330 | 447 | PF07690 | Major facilitator superfamily MFS_1 | |
HMMTigr | IPR005988 | 1 | 480 | TIGR01299 | Synaptic vesicle protein SV2 |
ProfileScan | IPR007114 | 1 | 475 | PS50850 | Major facilitator superfamily |
ScanRegExp | IPR005829 | 3 | 28 | PS00217 | Sugar transporter superfamily |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 2 | LLSGFGIGGAIPTVFSYFAEVLA | 24 | SECONDARY | 23 | 2 | 33 | SWLCMFWMIGGIYASAMAWAIIP | 55 | PRIMARY | 23 | 3 | 70 | HSWRVFVIVCALPCVSSVVALTF | 92 | PRIMARY | 23 | 4 | 334 | WIYFVNFLGTLAVLPGNIVSALL | 356 | PRIMARY | 23 | 5 | 362 | RLTMLGGSMVLSGISCFFLWFG | 383 | PRIMARY | 22 | 6 | 386 | ESMMIGMLCLYNGLTISAWNSLD | 408 | SECONDARY | 23 | 7 | 423 | GFGFLNALCKAAAVLGNLIFGSL | 445 | SECONDARY | 23 | 8 | 455 | LLASTVLVCGGLVGLCLPDTRTQ | 477 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | GTCATTTCCAAAGCAGTCCAG |
---|---|
Primer_r | GAGCCTTTAGTGCATGAACAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GTCATTTCCAAAGCAGTCCAG |
Primer_r | GAGCCTTTAGTGCATGAACAG |
PCR product length | 159 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |