Order Kazusa clone(s) from : ![]() |
Product ID | ORK07499 |
---|---|
Accession No | AB058774 |
Description | zinc finger protein 594 |
Clone name | hj05256s1 |
Vector information | |
cDNA sequence | DNA sequence (4862 bp) Predicted protein sequence (821 aa) |
Source | Human adult brain |
Note | We replaced hj05256, former representative clones for KIAA1871 with hj05256s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 2297 bp |
---|---|
Genome contig ID | gi51511734r_4923555 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | r | 5023555 | 5028416 | 1 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 141 | 164 | PD000003 | Zinc finger |
IPR007087 | 169 | 192 | PD000003 | Zinc finger | |
IPR007087 | 197 | 220 | PD000003 | Zinc finger | |
IPR007087 | 225 | 248 | PD000003 | Zinc finger | |
IPR007087 | 253 | 276 | PD000003 | Zinc finger | |
IPR007087 | 281 | 304 | PD000003 | Zinc finger | |
IPR007087 | 310 | 332 | PD000003 | Zinc finger | |
IPR007087 | 418 | 441 | PD000003 | Zinc finger | |
IPR007087 | 447 | 469 | PD000003 | Zinc finger | |
IPR007087 | 474 | 497 | PD000003 | Zinc finger | |
IPR007087 | 502 | 525 | PD000003 | Zinc finger | |
IPR007087 | 530 | 552 | PD000003 | Zinc finger | |
IPR007087 | 610 | 633 | PD000003 | Zinc finger | |
IPR007087 | 638 | 661 | PD000003 | Zinc finger | |
IPR007087 | 666 | 689 | PD000003 | Zinc finger | |
IPR007087 | 694 | 717 | PD000003 | Zinc finger | |
IPR007087 | 722 | 744 | PD000003 | Zinc finger | |
HMMPfam | IPR007087 | 141 | 163 | PF00096 | Zinc finger |
IPR007087 | 169 | 191 | PF00096 | Zinc finger | |
IPR007087 | 197 | 219 | PF00096 | Zinc finger | |
IPR007087 | 225 | 247 | PF00096 | Zinc finger | |
IPR007087 | 253 | 275 | PF00096 | Zinc finger | |
IPR007087 | 281 | 303 | PF00096 | Zinc finger | |
IPR007087 | 309 | 331 | PF00096 | Zinc finger | |
IPR007087 | 337 | 359 | PF00096 | Zinc finger | |
IPR007087 | 390 | 412 | PF00096 | Zinc finger | |
IPR007087 | 418 | 440 | PF00096 | Zinc finger | |
IPR007087 | 446 | 468 | PF00096 | Zinc finger | |
IPR007087 | 474 | 496 | PF00096 | Zinc finger | |
IPR007087 | 502 | 524 | PF00096 | Zinc finger | |
IPR007087 | 530 | 552 | PF00096 | Zinc finger | |
IPR007087 | 582 | 604 | PF00096 | Zinc finger | |
IPR007087 | 610 | 632 | PF00096 | Zinc finger | |
IPR007087 | 638 | 660 | PF00096 | Zinc finger | |
IPR007087 | 666 | 688 | PF00096 | Zinc finger | |
IPR007087 | 694 | 716 | PF00096 | Zinc finger | |
IPR007087 | 722 | 744 | PF00096 | Zinc finger | |
IPR007087 | 775 | 797 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 113 | 135 | SM00355 | Zinc finger |
IPR015880 | 141 | 163 | SM00355 | Zinc finger | |
IPR015880 | 169 | 191 | SM00355 | Zinc finger | |
IPR015880 | 197 | 219 | SM00355 | Zinc finger | |
IPR015880 | 225 | 247 | SM00355 | Zinc finger | |
IPR015880 | 253 | 275 | SM00355 | Zinc finger | |
IPR015880 | 281 | 303 | SM00355 | Zinc finger | |
IPR015880 | 309 | 331 | SM00355 | Zinc finger | |
IPR015880 | 337 | 359 | SM00355 | Zinc finger | |
IPR015880 | 390 | 412 | SM00355 | Zinc finger | |
IPR015880 | 418 | 440 | SM00355 | Zinc finger | |
IPR015880 | 446 | 468 | SM00355 | Zinc finger | |
IPR015880 | 474 | 496 | SM00355 | Zinc finger | |
IPR015880 | 502 | 524 | SM00355 | Zinc finger | |
IPR015880 | 530 | 552 | SM00355 | Zinc finger | |
IPR015880 | 582 | 604 | SM00355 | Zinc finger | |
IPR015880 | 610 | 632 | SM00355 | Zinc finger | |
IPR015880 | 638 | 660 | SM00355 | Zinc finger | |
IPR015880 | 666 | 688 | SM00355 | Zinc finger | |
IPR015880 | 694 | 716 | SM00355 | Zinc finger | |
IPR015880 | 722 | 744 | SM00355 | Zinc finger | |
IPR015880 | 775 | 797 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 141 | 168 | PS50157 | Zinc finger |
IPR007087 | 169 | 196 | PS50157 | Zinc finger | |
IPR007087 | 197 | 224 | PS50157 | Zinc finger | |
IPR007087 | 225 | 252 | PS50157 | Zinc finger | |
IPR007087 | 253 | 280 | PS50157 | Zinc finger | |
IPR007087 | 281 | 308 | PS50157 | Zinc finger | |
IPR007087 | 309 | 336 | PS50157 | Zinc finger | |
IPR007087 | 337 | 364 | PS50157 | Zinc finger | |
IPR007087 | 362 | 389 | PS50157 | Zinc finger | |
IPR007087 | 390 | 417 | PS50157 | Zinc finger | |
IPR007087 | 418 | 445 | PS50157 | Zinc finger | |
IPR007087 | 446 | 473 | PS50157 | Zinc finger | |
IPR007087 | 474 | 501 | PS50157 | Zinc finger | |
IPR007087 | 502 | 529 | PS50157 | Zinc finger | |
IPR007087 | 530 | 557 | PS50157 | Zinc finger | |
IPR007087 | 582 | 609 | PS50157 | Zinc finger | |
IPR007087 | 610 | 637 | PS50157 | Zinc finger | |
IPR007087 | 638 | 665 | PS50157 | Zinc finger | |
IPR007087 | 666 | 693 | PS50157 | Zinc finger | |
IPR007087 | 694 | 721 | PS50157 | Zinc finger | |
IPR007087 | 722 | 749 | PS50157 | Zinc finger | |
IPR007087 | 775 | 802 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 143 | 163 | PS00028 | Zinc finger |
IPR007087 | 199 | 219 | PS00028 | Zinc finger | |
IPR007087 | 227 | 247 | PS00028 | Zinc finger | |
IPR007087 | 255 | 275 | PS00028 | Zinc finger | |
IPR007087 | 283 | 303 | PS00028 | Zinc finger | |
IPR007087 | 311 | 331 | PS00028 | Zinc finger | |
IPR007087 | 339 | 359 | PS00028 | Zinc finger | |
IPR007087 | 392 | 412 | PS00028 | Zinc finger | |
IPR007087 | 420 | 440 | PS00028 | Zinc finger | |
IPR007087 | 446 | 468 | PS00028 | Zinc finger | |
IPR007087 | 476 | 496 | PS00028 | Zinc finger | |
IPR007087 | 504 | 524 | PS00028 | Zinc finger | |
IPR007087 | 532 | 552 | PS00028 | Zinc finger | |
IPR007087 | 584 | 604 | PS00028 | Zinc finger | |
IPR007087 | 612 | 632 | PS00028 | Zinc finger | |
IPR007087 | 640 | 660 | PS00028 | Zinc finger | |
IPR007087 | 668 | 688 | PS00028 | Zinc finger | |
IPR007087 | 696 | 716 | PS00028 | Zinc finger | |
IPR007087 | 724 | 744 | PS00028 | Zinc finger | |
IPR007087 | 777 | 797 | PS00028 | Zinc finger |
![]() |
Primer_f | TACTCCCCTATGTCCTGTGTC |
---|---|
Primer_r | TTGGGCTGGAATTTTAGTACC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |