KIAA0962

Product ID	ORK00699
Accession No	AB023179
Description	DnaJ (Hsp40) homolog, subfamily C, member 16, transcript variant 1
Clone name	hj05850s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6035 bp) Predicted protein sequence (822 aa)
HaloTag ORF Clone	FHC00699
Flexi ORF Clone	FXC00699
Source	Human adult brain
Rouge ID	mKIAA0962 by Kazusa Mouse cDNA Project
Note	We replaced hj05850, former representative clones for KIAA0962 with hj05850s1. (2002/5/10)

Length: 6035 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	3566 bp
Genome contig ID	gi89161185f_15625939
PolyA signal sequence (GATAAA,-15)	+--------+--------+----*----+---- AATAAACTATTTTAATGTCTGATAAAAAAAAAAAC
Flanking genome sequence	None

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	15725939	15770815	15	100.0	Terminal No-hit

Length: 822 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_513050	99.5	DnaJ (Hsp40) ho...	Pan troglodytes
Q9Y2G8	100.0	DnaJ homolog su...	Homo sapiens
BAF85168	99.9	unnamed protein...	Homo sapiens
Q5RCM7	98.2	DnaJ homolog su...	Pongo abelii
XP_001489818	94.2	similar to DnaJ...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058733	0.00013	23.7	KIAA1830

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR003095	80	99	PR00625	Heat shock protein DnaJ
FPrintScan	IPR003095	110	130	PR00625	Heat shock protein DnaJ
HMMPfam	IPR001623	69	130	PF00226	Heat shock protein DnaJ
HMMSmart	IPR001623	68	125	SM00271	Heat shock protein DnaJ
ProfileScan	IPR001623	69	133	PS50076	Heat shock protein DnaJ
ScanRegExp	IPR001623	110	129	PS00636	Heat shock protein DnaJ

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	46	LSISWQFLIVLVLILQILSALDF	68	PRIMARY	23
SOSUI2	2	577	MPLLSLIFSALFILFGTVIVQAF	599	PRIMARY	23

Primer_f	CAGCCAGTTAGAGAGCATACC
Primer_r	CCTTGCTTTGACATTTGAACG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-