Order Kazusa clone(s) from : ![]() |
Product ID | ORK00789 |
---|---|
Accession No | AB033092 |
Description | metastasis associated 1 family, member 3, transcript variant 1 |
Clone name | hj06235 |
Vector information | |
cDNA sequence | DNA sequence (5484 bp) Predicted protein sequence (601 aa) |
HaloTag ORF Clone |
FHC00789
![]() |
Flexi ORF Clone | FXC00789 |
Source | Human adult brain |
Rouge ID |
mKIAA1266
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3548 bp |
---|---|
Genome contig ID | gi89161199f_42548689 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (288903 - 288952) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | f | 42648689 | 42837590 | 17 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001025 | 18 | 155 | PF01426 | Bromo adjacent region |
IPR000949 | 156 | 217 | PF01448 | ELM2 | |
IPR014778 | 276 | 322 | PF00249 | Myb | |
IPR000679 | 386 | 423 | PF00320 | Zinc finger | |
HMMSmart | IPR001025 | 12 | 155 | SM00439 | Bromo adjacent region |
IPR001005 | 275 | 324 | SM00717 | SANT | |
IPR000679 | 380 | 434 | SM00401 | Zinc finger | |
ProfileScan | IPR001025 | 12 | 155 | PS51038 | Bromo adjacent region |
IPR000949 | 156 | 267 | PS51156 | ELM2 |
![]() |
Primer_f | CCTGTTCCTCTGCACTATGTC |
---|---|
Primer_r | CCTTACAGACAGACAATCCAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCTGTTCCTCTGCACTATGTC |
Primer_r | CCTTACAGACAGACAATCCAC |
PCR product length | 137 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |