KIAA0976

Product ID	ORK00705
Accession No	AB023193
Description	netrin G1
Clone name	hj06950
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4704 bp) Predicted protein sequence (386 aa)
HaloTag ORF Clone	FHC00705
Flexi ORF Clone	FXC00705
Source	Human adult brain
Rouge ID	mKIAA0976 by Kazusa Mouse cDNA Project

Length: 4704 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2870 bp
Genome contig ID	gi89161185f_107385072
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AATTAATGAATCCCAAAATAAATCTGTAGCCTTTG
Flanking genome sequence (369660 - 369709)	----+--------+--------+--------+--------+----* AGCCTTATGATCTATGTTTTCACTTTACCTGATGTGGTAGGAATTCCTTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	107485072	107754730	5	99.4	Perfect prediction

Length: 386 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAH73828	8.8e-166	100.0	netrin G1 [Homo...	Homo sapiens
CAD98143	8.8e-166	100.0	hypothetical pr...	Homo sapiens
AAH30220	4.1e-165	99.7	Netrin G1 [Homo...	Homo sapiens
CAH73833	5e-165	99.7	netrin G1 [Homo...	Homo sapiens
CAH73829	5.1e-165	99.7	netrin G1 [Homo...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058760	1.3e-84	57.5	KIAA1857
AB067494	4.5e-11	29.7	KIAA1907

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008211	72	317	PF00055	Laminin
HMMPfam	IPR002049	319	363	PF00053	EGF-like
HMMSmart	IPR008211	81	317	SM00136	Laminin
HMMSmart	IPR002049	319	376	SM00180	EGF-like
ProfileScan	IPR008211	68	318	PS51117	Laminin
ScanRegExp	IPR013032	337	348	PS00022	EGF-like region

Primer_f	AAATGCATGGATAGGGTGGTC
Primer_r	AGATAGACAACAGCAGGTACG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AAATGCATGGATAGGGTGGTC
Primer_r	AGATAGACAACAGCAGGTACG
PCR product length	100 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles