KIAA0657

Product ID	ORK06218
Accession No	AB014557
Description	obscurin-like 1
Clone name	hk01859s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5382 bp) Predicted protein sequence (1237 aa)
Source	Human adult brain
Rouge ID	mKIAA0657 by Kazusa Mouse cDNA Project
Note	We replaced hk01859, former representative clones for KIAA0657 with hk01859s1. (2002/5/10)

Length: 5382 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1667 bp
Genome contig ID	gi89161199r_220023695
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TAGAGAGACAAGGAACAATAAAAGTGCTACAGCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTCCTTGCCTCTCTGAGTGATGTGGGGGGGCAGACCTTGCCTGGAGCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	220123695	220143707	16	99.5	Perfect prediction

Length: 1237 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O75147	100.0	Obscurin-like p...	Homo sapiens
EAW70766	99.9	chondroitin pol...	Homo sapiens
ABO42328	92.4	obscurin-like 1...	Homo sapiens
ABO42327	92.3	obscurin-like 1...	Homo sapiens
ACJ76613	86.6	obscurin-like 1...	Oryctolagus cun...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046776	1.3e-14	27.1	KIAA1556
D86983	2.3e-07	25.1	KIAA0230
AB046788	9.6e-07	25.1	KIAA1568

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013098	30	62	PF07679	Immunoglobulin I-set
	IPR013098	87	172	PF07679	Immunoglobulin I-set
	IPR013098	177	262	PF07679	Immunoglobulin I-set
	IPR003961	351	437	PF00041	Fibronectin
	IPR013151	567	626	PF00047	Immunoglobulin
	IPR013151	658	717	PF00047	Immunoglobulin
	IPR013151	749	808	PF00047	Immunoglobulin
	IPR013151	840	899	PF00047	Immunoglobulin
	IPR013151	932	991	PF00047	Immunoglobulin
	IPR013098	1044	1087	PF07679	Immunoglobulin I-set
	IPR013151	1118	1151	PF00047	Immunoglobulin
HMMSmart	IPR003599	2	63	SM00409	Immunoglobulin subtype
	IPR003599	88	173	SM00409	Immunoglobulin subtype
	IPR003598	94	162	SM00408	Immunoglobulin subtype 2
	IPR003599	183	263	SM00409	Immunoglobulin subtype
	IPR003598	189	255	SM00408	Immunoglobulin subtype 2
	IPR003599	271	347	SM00409	Immunoglobulin subtype
	IPR003599	458	547	SM00409	Immunoglobulin subtype
	IPR003599	559	640	SM00409	Immunoglobulin subtype
	IPR003598	565	631	SM00408	Immunoglobulin subtype 2
	IPR003599	650	729	SM00409	Immunoglobulin subtype
	IPR003598	656	722	SM00408	Immunoglobulin subtype 2
	IPR003599	741	820	SM00409	Immunoglobulin subtype
	IPR003598	747	813	SM00408	Immunoglobulin subtype 2
	IPR003599	832	911	SM00409	Immunoglobulin subtype
	IPR003598	838	904	SM00408	Immunoglobulin subtype 2
	IPR003599	924	1007	SM00409	Immunoglobulin subtype
	IPR003598	930	996	SM00408	Immunoglobulin subtype 2
	IPR003599	1020	1099	SM00409	Immunoglobulin subtype
	IPR003598	1026	1092	SM00408	Immunoglobulin subtype 2
ProfileScan	IPR007110	79	166	PS50835	Immunoglobulin-like
	IPR007110	175	261	PS50835	Immunoglobulin-like
	IPR003961	353	446	PS50853	Fibronectin
	IPR007110	550	636	PS50835	Immunoglobulin-like
	IPR007110	640	729	PS50835	Immunoglobulin-like
	IPR007110	738	818	PS50835	Immunoglobulin-like
	IPR007110	822	911	PS50835	Immunoglobulin-like
	IPR007110	913	1005	PS50835	Immunoglobulin-like
	IPR007110	1009	1087	PS50835	Immunoglobulin-like
	IPR007110	1101	1140	PS50835	Immunoglobulin-like

Primer_f	GCTCTTTGTGTACTGGTGTCC
Primer_r	GCAAACGCCTTCCAAGCTGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GCTCTTTGTGTACTGGTGTCC
Primer_r	GCAAACGCCTTCCAAGCTGTC
PCR product length	154 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles