Order Kazusa clone(s) from : ![]() |
Product ID | ORK00602 |
---|---|
Accession No | AB014577 |
Description | lysine (K)-specific demethylase 4A |
Clone name | hk02635 |
Vector information | |
cDNA sequence | DNA sequence (4417 bp) Predicted protein sequence (1073 aa) |
Flexi ORF Clone | FXC00602 |
Source | Human adult brain |
Rouge ID |
mKIAA0677
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR003349 | 24 | 69 | PF02375 | Transcription factor jumonji |
IPR013129 | 184 | 300 | PF02373 | Transcription factor jumonji | |
IPR001965 | 744 | 778 | PF00628 | Zinc finger | |
HMMSmart | IPR003349 | 22 | 64 | SM00545 | Transcription factor jumonji |
IPR003347 | 151 | 317 | SM00558 | Transcription factor jumonji/aspartyl beta-hydroxylase | |
IPR001965 | 718 | 776 | SM00249 | Zinc finger | |
IPR001965 | 838 | 894 | SM00249 | Zinc finger | |
IPR002999 | 906 | 963 | SM00333 | Tudor | |
IPR002999 | 964 | 1020 | SM00333 | Tudor | |
ProfileScan | IPR003349 | 23 | 65 | PS51183 | Transcription factor jumonji |
IPR003347 | 151 | 317 | PS51184 | Transcription factor jumonji/aspartyl beta-hydroxylase |
![]() |
---|
Primer_f | CCGCTGTAGTGAAAGGACGAG |
---|---|
Primer_r | GTTGACCCCTCTATGGACTGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCGCTGTAGTGAAAGGACGAG |
Primer_r | GTTGACCCCTCTATGGACTGG |
PCR product length | 121 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |