|
Order Kazusa clone(s) from : |
| Product ID | ORK05796 |
|---|---|
| Accession No | AB014581 |
| Description | l(3)mbt-like 1 (Drosophila) |
| Clone name | hk02748 |
| Vector information | |
| cDNA sequence | DNA sequence (4323 bp) Predicted protein sequence (538 aa) |
| Source | Human adult brain |
| Rouge ID |
mKIAA0681
by Kazusa Mouse cDNA Project
|
Length: 4323 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Length: 538 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR004092 | 28 | 101 | PF02820 | Mbt repeat |
| IPR004092 | 135 | 208 | PF02820 | Mbt repeat | |
| IPR004092 | 239 | 312 | PF02820 | Mbt repeat | |
| IPR002515 | 337 | 367 | PF01530 | Zinc finger | |
| IPR001660 | 467 | 531 | PF00536 | Sterile alpha motif SAM | |
| HMMSmart | IPR004092 | 1 | 92 | SM00561 | Mbt repeat |
| IPR004092 | 100 | 199 | SM00561 | Mbt repeat | |
| IPR004092 | 208 | 303 | SM00561 | Mbt repeat | |
| IPR001660 | 466 | 533 | SM00454 | Sterile alpha motif SAM | |
| ProfileScan | IPR004092 | 1 | 92 | PS51079 | Mbt repeat |
| IPR004092 | 100 | 199 | PS51079 | Mbt repeat | |
| IPR004092 | 208 | 303 | PS51079 | Mbt repeat | |
| IPR001660 | 469 | 533 | PS50105 | Sterile alpha motif SAM |
RT-PCR
|
|---|
RT-PCR-ELISA
|
Experimental conditions| Primer_f | TGTGGTGAAGGCAAGATGGAC |
|---|---|
| Primer_r | TATCATTTGGGGACAGAGTGG |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 20
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | TGTGGTGAAGGCAAGATGGAC |
| Primer_r | TATCATTTGGGGACAGAGTGG |
| PCR product length | 185 bp |
| PCR conditions | 95 °C 15 sec 64 °C 60 sec 30 cycles |