KIAA0725

Product ID	ORK04722
Accession No	AB018268
Description	DDHD domain containing 2
Clone name	hk02781
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3911 bp) Predicted protein sequence (573 aa)
Source	Human adult brain
Rouge ID	mKIAA0725 by Kazusa Mouse cDNA Project

Length: 3911 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2188 bp
Genome contig ID	gi51511724f_38114215
PolyA signal sequence (AGTAAA,-16)	+--------+--------+----*----+---- TGATTATATTTAAAACTTTAGTAAATACTAAAATG
Flanking genome sequence (125223 - 125272)	----+--------+--------+--------+--------+----* AAACCATATTGACTAGTGGCCTACTTTTACCTGGACTCACCCGTCTCAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	f	38214215	38239436	15	99.4	Perfect prediction

Length: 573 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10373	99.8	DDHD domain-con...	synthetic construct
O94830	99.7	Phospholipase D...	Homo sapiens
XP_519711	99.5	DDHD domain con...	Pan troglodytes
BAG51738	99.3	unnamed protein...	Homo sapiens
XP_532805	93.4	similar to DDHD...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051492	4.9e-12	27.6	KIAA1705
AB040890	0.00093	22.4	KIAA1457

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001660	245	307	PF00536	Sterile alpha motif SAM
HMMPfam	IPR004177	357	562	PF02862	DDHD
HMMSmart	IPR001660	244	309	SM00454	Sterile alpha motif SAM
ProfileScan	IPR004177	357	562	PS51043	DDHD

Primer_f	GGTGGGTAACTGTGAAAGAGC
Primer_r	ATGATACAAATGAAGCAGCGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GGTGGGTAACTGTGAAAGAGC
Primer_r	ATGATACAAATGAAGCAGCGC
PCR product length	131 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles