Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04586 |
---|---|
Accession No | AB018269 |
Description | calsyntenin 3 |
Clone name | hk02972 |
Vector information | |
cDNA sequence | DNA sequence (4300 bp) Predicted protein sequence (973 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0726
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002126 | 121 | 133 | PR00205 | Cadherin |
IPR002126 | 141 | 160 | PR00205 | Cadherin | |
IPR002126 | 160 | 173 | PR00205 | Cadherin | |
IPR002126 | 213 | 239 | PR00205 | Cadherin | |
HMMPfam | IPR002126 | 50 | 153 | PF00028 | Cadherin |
IPR002126 | 167 | 256 | PF00028 | Cadherin | |
HMMSmart | IPR002126 | 67 | 160 | SM00112 | Cadherin |
IPR002126 | 183 | 261 | SM00112 | Cadherin | |
ProfileScan | IPR002126 | 46 | 162 | PS50268 | Cadherin |
IPR002126 | 163 | 263 | PS50268 | Cadherin |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 6 | MVLGCELSGSTRVVVGVEALLTG | 28 | SECONDARY | 23 | 2 | 864 | AATLIIVVCVGFLVLMVVLGLVR | 886 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | CTGCCTACCTCACTATTGCTG |
---|---|
Primer_r | GGTATCATGGAGTTTCTGTGG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GGAGAGAGGCTTCAGAACCAG |
Primer_r | AGGAGCATGACAGCCCAGAAG |
PCR product length | 116 bp |
PCR conditions | 95 °C15 sec66 °C60 sec30 cycles |