Order Kazusa clone(s) from : ![]() |
Product ID | ORK00607 |
---|---|
Accession No | AB014593 |
Description | synovial sarcoma translocation gene on chromosome 18-like 1, transcript variant 1 |
Clone name | hk03927 |
Vector information | |
cDNA sequence | DNA sequence (4493 bp) Predicted protein sequence (404 aa) |
Flexi ORF Clone | FXC00607 |
Source | Human adult brain |
Rouge ID |
mKIAA0693
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3276 bp |
---|---|
Genome contig ID | gi51511747f_60052246 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (138691 - 138740) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 20 | f | 60152246 | 60190935 | 11 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | NULL | 9 | 76 | PD020165 | NULL |
HMMPfam | IPR007726 | 19 | 84 | PF05030 | SSXT |
ScanRegExp | IPR000532 | 108 | 130 | PS00260 | Glucagon/GIP/secretin/VIP |
![]() |
---|
![]() |
Primer_f | TGAAGTGTGGTTGATGGTGCT |
---|---|
Primer_r | ATAGGAAGAAGAATGAGCGTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TGAAGTGTGGTTGATGGTGCT |
Primer_r | ATAGGAAGAAGAATGAGCGTC |
PCR product length | 104 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |