KIAA0784

Product ID	ORK04057
Accession No	AB018327
Description	activity-dependent neuroprotector homeobox
Clone name	hk05410
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4282 bp) Predicted protein sequence (1073 aa)
Source	Human adult brain
Rouge ID	mKIAA0784 by Kazusa Mouse cDNA Project

Length: 4282 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1059 bp
Genome contig ID	gi51511747r_48840290
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- AGCATCTAAATAAATTGCTGTATTGTGCTTAATGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATATTTGCTTTATTACACATGACAGTCCTGTGTGTCCATTATATCTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	48940290	48953854	3	99.0	Perfect prediction

Length: 1073 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9H2P0	100.0	Activity-depend...	Homo sapiens
BAG37275	99.9	unnamed protein...	Homo sapiens
AAH75794	99.8	Activity-depend...	Homo sapiens
XP_001168472	99.7	activity-depend...	Pan troglodytes
XP_001095183	99.5	similar to acti...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020670	3.2e-10	26.3	KIAA0863

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	483	506	PF00096	Zinc finger
HMMPfam	IPR001356	735	784	PF00046	Homeobox
HMMSmart	IPR015880	45	68	SM00355	Zinc finger
	IPR015880	78	100	SM00355	Zinc finger
	IPR015880	136	159	SM00355	Zinc finger
	IPR015880	192	215	SM00355	Zinc finger
	IPR015880	418	440	SM00355	Zinc finger
	IPR015880	460	481	SM00355	Zinc finger
	IPR015880	483	506	SM00355	Zinc finger
	IPR015880	593	618	SM00355	Zinc finger
	IPR001356	728	789	SM00389	Homeobox
ProfileScan	IPR007087	483	511	PS50157	Zinc finger
ProfileScan	IPR001356	742	785	PS50071	Homeobox
ScanRegExp	IPR003439	312	326	PS00211	ABC transporter related
ScanRegExp	IPR007087	485	506	PS00028	Zinc finger

Primer_f	TTAGACCTATTCAAGTGATGC
Primer_r	AGCGTTTATTACACAGCAAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-