Order Kazusa clone(s) from : ![]() |
Product ID | ORK00835 |
---|---|
Accession No | AB037859 |
Description | megakaryoblastic leukemia (translocation) 1, transcript variant 1 |
Clone name | hk07374s1 |
Vector information | |
cDNA sequence | DNA sequence (4494 bp) Predicted protein sequence (1075 aa) |
HaloTag ORF Clone |
FHC00835
![]() |
Flexi ORF Clone | FXC00835 |
Source | Human adult brain |
Note | We replaced hk07374, former representative clones for KIAA1438 with hk07374s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1101 bp |
---|---|
Genome contig ID | gi89161203r_39036239 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 22 | r | 39136239 | 39362641 | 15 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR003034 | 491 | 525 | PF02037 | DNA-binding SAP |
HMMSmart | IPR004018 | 124 | 149 | SM00707 | RPEL repeat |
IPR004018 | 168 | 193 | SM00707 | RPEL repeat | |
IPR004018 | 212 | 237 | SM00707 | RPEL repeat | |
IPR003034 | 491 | 525 | SM00513 | DNA-binding SAP | |
ProfileScan | IPR004018 | 124 | 149 | PS51073 | RPEL repeat |
IPR004018 | 168 | 193 | PS51073 | RPEL repeat | |
IPR004018 | 212 | 237 | PS51073 | RPEL repeat | |
IPR003034 | 491 | 525 | PS50800 | DNA-binding SAP |
![]() |
Primer_f | CCCTGCCATTTTAGTGTCTTG |
---|---|
Primer_r | AGTAGGATGGGAGGGAGTTGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCCTGCCATTTTAGTGTCTTG |
Primer_r | AGTAGGATGGGAGGGAGTTGC |
PCR product length | 159 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |