KIAA1400

Product ID	ORK01629
Accession No	AB037821
Description	protocadherin 10, transcript variant 1
Clone name	hk08136
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4554 bp) Predicted protein sequence (1093 aa)
HaloTag ORF Clone	FHC01629
Flexi ORF Clone	FXC01629
Source	Human adult brain
Rouge ID	mKIAA1400 by Kazusa Mouse cDNA Project

Length: 4554 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	605 bp
Genome contig ID	gi89161207f_134189920
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TCAAAGCTTCTAAATAAATATAAAATATATATATT
Flanking genome sequence (141452 - 141501)	----+--------+--------+--------+--------+----* ATATTATATAATTTTCCTAAAATGTGGTACAACTCAGTTGGTTTTTAAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	134289920	134331370	5	99.2	Perfect prediction

Length: 1093 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2E7	100.0	Protocadherin-1...	Homo sapiens
XP_001134989	99.9	protocadherin 1...	Pan troglodytes
AAI11561	99.9	Protocadherin 1...	Homo sapiens
XP_869875	98.7	similar to prot...	Bos taurus
AAK57195	97.4	OL-protocadheri...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046782	2.1e-63	37.8	KIAA1562
AB011160	5.2e-62	40.0	KIAA0588
AB002343	4.5e-58	41.9	KIAA0345
AB002325	4.5e-27	43.9	KIAA0327
AB053445	2.3e-24	29.7	KIAA1774

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	115	134	PR00205	Cadherin
	IPR002126	303	332	PR00205	Cadherin
	IPR002126	481	493	PR00205	Cadherin
	IPR002126	495	514	PR00205	Cadherin
	IPR002126	514	527	PR00205	Cadherin
	IPR002126	574	600	PR00205	Cadherin
	IPR002126	609	626	PR00205	Cadherin
HMMPfam	IPR013164	71	154	PF08266	Cadherin
	IPR002126	180	264	PF00028	Cadherin
	IPR002126	308	402	PF00028	Cadherin
	IPR002126	420	507	PF00028	Cadherin
	IPR002126	521	618	PF00028	Cadherin
	IPR002126	647	732	PF00028	Cadherin
HMMSmart	IPR002126	87	173	SM00112	Cadherin
	IPR002126	197	301	SM00112	Cadherin
	IPR002126	325	409	SM00112	Cadherin
	IPR002126	433	514	SM00112	Cadherin
	IPR002126	538	625	SM00112	Cadherin
	IPR002126	656	739	SM00112	Cadherin
ProfileScan	IPR002126	116	175	PS50268	Cadherin
	IPR002126	176	303	PS50268	Cadherin
	IPR002126	304	411	PS50268	Cadherin
	IPR002126	412	516	PS50268	Cadherin
	IPR002126	517	627	PS50268	Cadherin
	IPR002126	643	733	PS50268	Cadherin
ScanRegExp	IPR002126	163	173	PS00232	Cadherin
	IPR002126	291	301	PS00232	Cadherin
	IPR002126	399	409	PS00232	Cadherin
	IPR002126	504	514	PS00232	Cadherin
	IPR002126	615	625	PS00232	Cadherin
	IPR013032	812	823	PS00022	EGF-like region

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	19	ALLFVFFQIFFCFVVVGEVIGWL	41	PRIMARY	23
	2	50	FLLEMIVLLLFALLWMVEGVFSQ	72	PRIMARY	23
	3	768	TLILIIALGSVSFIFLLAMIVLA	790	PRIMARY	23

Primer_f	TGTCACTGAGCCCTTTAGATG
Primer_r	TTGGAATAGCTTGCGGAACAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGTCACTGAGCCCTTTAGATG
Primer_r	TTGGAATAGCTTGCGGAACAC
PCR product length	152 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles