Order Kazusa clone(s) from : ![]() |
Product ID | ORK01614 |
---|---|
Accession No | AB020698 |
Description | ubiquitin specific peptidase 19, transcript variant 4 |
Clone name | hk08201 |
Vector information | |
cDNA sequence | DNA sequence (4401 bp) Predicted protein sequence (1371 aa) |
HaloTag ORF Clone |
FHC01614
![]() |
Flexi ORF Clone | FXC01614 |
Source | Human adult brain |
Rouge ID |
mKIAA0891
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 283 bp |
---|---|
Genome contig ID | gi89161205r_49021112 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | r | 49121112 | 49133217 | 26 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR007052 | 169 | 244 | PF04969 | CS |
IPR015054 | 248 | 546 | PF08959 | Domain of unknown function DUF1872 | |
IPR001394 | 547 | 1264 | PF00443 | Peptidase C19 | |
IPR002893 | 844 | 886 | PF01753 | Zinc finger | |
ProfileScan | IPR007052 | 166 | 255 | PS51203 | CS |
IPR007052 | 335 | 437 | PS51203 | CS | |
IPR001394 | 550 | 1268 | PS50235 | Peptidase C19 | |
IPR002893 | 844 | 886 | PS50865 | Zinc finger | |
ScanRegExp | IPR001394 | 551 | 566 | PS00972 | Peptidase C19 |
IPR002893 | 844 | 886 | PS01360 | Zinc finger | |
IPR001394 | 1202 | 1219 | PS00973 | Peptidase C19 |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1 | AGCGGLARLSVPCWRIWPQRAAK | 23 | SECONDARY | 23 | 2 | 1342 | LRYFVLGTVAALVALVLNVFYPL | 1364 | PRIMARY | 23 |
---|
![]() |
Primer_f | CATGCCTGCCTTTGTTGTGGG |
---|---|
Primer_r | AGAGCAGCAGGATGAATGGAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCCATGCCTGCCTTTGTTGTG |
Primer_r | CAGACAGCCAGATGGATACAC |
PCR product length | 135 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |