Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK06681 |
---|---|
Accession No | AB023222 |
Description | RPGRIP1-like |
Clone name | hk10066 |
Vector information | |
cDNA sequence | DNA sequence (4557 bp) Predicted protein sequence (1055 aa) |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1388 bp |
---|---|
Genome contig ID | gi51511732r_52092101 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 16 | r | 52192101 | 52279368 | 21 | 100.0 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000008 | 612 | 701 | PF00168 | C2 calcium-dependent membrane targeting |
HMMSmart | IPR000008 | 435 | 532 | SM00239 | C2 calcium-dependent membrane targeting |
IPR000008 | 611 | 716 | SM00239 | C2 calcium-dependent membrane targeting | |
ProfileScan | IPR000008 | 610 | 701 | PS50004 | C2 calcium-dependent membrane targeting |
RT-PCR-ELISA |
Primer_f | GTTAGACGTGAAAGGAGTATC |
---|---|
Primer_r | GTGAGATTGGGTAAAAGCTAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GTTAGACGTGAAAGGAGTATC |
Primer_r | GTGAGATTGGGTAAAAGCTAG |
PCR product length | 137 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |