KIAA1005

Product ID	ORK06681
Accession No	AB023222
Description	RPGRIP1-like
Clone name	hk10066
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hk10066 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCGC CCACGCGTCC GCCCACGCGT CCG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (4557 bp) Predicted protein sequence (1055 aa)
Source	Human adult brain

Length: 4557 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1388 bp
Genome contig ID	gi51511732r_52092101
PolyA signal sequence (None)	+--------+--------+----*----+---- AATAGATTATGAGACAATTCATTACAGTTCAATAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAGCAGCTATAATGCAAAAATGCAAGTATGAATATCTGCATAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	r	52192101	52279368	21	100.0	Perfect prediction

Length: 1055 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001166735	99.1	hypothetical pr...	Pan troglodytes
XP_001086391	97.1	similar to reti...	Macaca mulatta
AAI36434	96.6	Unknown (protei...	Homo sapiens
NP_056087	92.9	RPGRIP1-like is...	Homo sapiens
BAG65540	94.6	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000008	612	701	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	435	532	SM00239	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	611	716	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000008	610	701	PS50004	C2 calcium-dependent membrane targeting

Primer_f	GTTAGACGTGAAAGGAGTATC
Primer_r	GTGAGATTGGGTAAAAGCTAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GTTAGACGTGAAAGGAGTATC
Primer_r	GTGAGATTGGGTAAAAGCTAG
PCR product length	137 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles