Gene/Protein Characteristic Table for KIAA0813
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00644
Accession No AB011537
Description slit guidance ligand 1
Clone name pf00581
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (7931 bp)
Predicted protein sequence (1618 aa)
Flexi ORF Clone FXC00644
Source Human brain (hippocampus)
Rouge ID mKIAA0813 by Kazusa Mouse cDNA Project
Note We replaced hh00849, former representative clones for KIAA0813 with pf00581. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 7931 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 3074 bp
Genome contig ID gi89161187r_98647785
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
GTCTTCCATGTGAACATGACATTGAGTCACTCTGC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
CTTGTTGGTCTCTTTTTCTCCACCAAGGGCGGGCCGGGTGCTGCTGGCAT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 10 r 98747785 98935673 37 99.5 Perfect prediction
Features of the protein sequence
Description

Length: 1618 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAA32465 0 100.0 MEGF4 [Homo sap...
 Homo sapiens
XP_001094231 0 96.2 slit homolog 1 ...
 Macaca mulatta
AAI46762 0 100.0 Slit homolog 1 ...
 Homo sapiens
O75093 0 99.9 Slit homolog 1 ...
 Homo sapiens
BAA35184 0 99.8 Slit-1 protein ...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB011538 2.4e-202 59.0 KIAA0814
D86983 8e-14 35.9 KIAA0230
AB053450 2e-11 22.7 KIAA1776
AB011539 3.6e-10 27.1 KIAA0815
D87469 5.9e-10 24.8 KIAA0279
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001611 219 232 PR00019 Leucine-rich repeat
IPR001611 648 661 PR00019 Leucine-rich repeat
HMMPfam IPR000372 117 144 PF01462 Leucine-rich repeat
IPR001611 146 168 PF00560 Leucine-rich repeat
IPR001611 170 192 PF00560 Leucine-rich repeat
IPR001611 194 216 PF00560 Leucine-rich repeat
IPR001611 218 240 PF00560 Leucine-rich repeat
IPR001611 242 264 PF00560 Leucine-rich repeat
IPR001611 266 288 PF00560 Leucine-rich repeat
IPR000483 323 348 PF01463 Cysteine-rich flanking region
IPR000372 365 392 PF01462 Leucine-rich repeat
IPR001611 418 440 PF00560 Leucine-rich repeat
IPR001611 442 464 PF00560 Leucine-rich repeat
IPR001611 466 488 PF00560 Leucine-rich repeat
IPR001611 490 512 PF00560 Leucine-rich repeat
IPR000483 547 572 PF01463 Cysteine-rich flanking region
IPR000372 596 623 PF01462 Leucine-rich repeat
IPR001611 650 672 PF00560 Leucine-rich repeat
IPR001611 674 696 PF00560 Leucine-rich repeat
IPR001611 698 720 PF00560 Leucine-rich repeat
IPR001611 722 744 PF00560 Leucine-rich repeat
IPR000483 779 804 PF01463 Cysteine-rich flanking region
IPR000372 817 844 PF01462 Leucine-rich repeat
IPR001611 846 867 PF00560 Leucine-rich repeat
IPR001611 869 891 PF00560 Leucine-rich repeat
IPR001611 893 915 PF00560 Leucine-rich repeat
IPR001611 917 939 PF00560 Leucine-rich repeat
IPR000483 974 999 PF01463 Cysteine-rich flanking region
IPR006209 1013 1045 PF00008 EGF-like
IPR006209 1052 1086 PF00008 EGF-like
IPR006209 1093 1124 PF00008 EGF-like
IPR006209 1131 1164 PF00008 EGF-like
IPR006209 1171 1202 PF00008 EGF-like
IPR006209 1215 1246 PF00008 EGF-like
IPR012680 1278 1406 PF02210 Laminin G
IPR006209 1426 1457 PF00008 EGF-like
IPR006209 1465 1496 PF00008 EGF-like
IPR006209 1506 1537 PF00008 EGF-like
HMMSmart IPR000372 117 149 SM00013 Leucine-rich repeat
IPR003591 143 167 SM00369 Leucine-rich repeat
IPR003591 168 191 SM00369 Leucine-rich repeat
IPR003591 192 215 SM00369 Leucine-rich repeat
IPR003591 217 239 SM00369 Leucine-rich repeat
NULL 240 261 SM00365 NULL
IPR003591 241 263 SM00369 Leucine-rich repeat
IPR003591 264 287 SM00369 Leucine-rich repeat
IPR000483 299 348 SM00082 Cysteine-rich flanking region
IPR000372 365 397 SM00013 Leucine-rich repeat
IPR003591 391 415 SM00369 Leucine-rich repeat
NULL 416 437 SM00365 NULL
IPR003591 416 439 SM00369 Leucine-rich repeat
IPR003591 440 463 SM00369 Leucine-rich repeat
IPR003591 464 487 SM00369 Leucine-rich repeat
NULL 488 506 SM00365 NULL
IPR003591 488 511 SM00369 Leucine-rich repeat
IPR000483 523 572 SM00082 Cysteine-rich flanking region
IPR000372 596 628 SM00013 Leucine-rich repeat
NULL 648 669 SM00365 NULL
IPR003591 648 671 SM00369 Leucine-rich repeat
IPR003591 673 695 SM00369 Leucine-rich repeat
NULL 696 717 SM00365 NULL
IPR003591 696 719 SM00369 Leucine-rich repeat
NULL 720 741 SM00365 NULL
IPR003591 720 743 SM00369 Leucine-rich repeat
IPR000483 755 804 SM00082 Cysteine-rich flanking region
IPR000372 817 849 SM00013 Leucine-rich repeat
NULL 867 888 SM00365 NULL
IPR003591 867 890 SM00369 Leucine-rich repeat
NULL 891 912 SM00365 NULL
IPR003591 891 914 SM00369 Leucine-rich repeat
IPR003591 915 938 SM00369 Leucine-rich repeat
IPR000483 950 999 SM00082 Cysteine-rich flanking region
IPR001881 1009 1046 SM00179 EGF-like calcium-binding
IPR006210 1012 1046 SM00181 EGF
IPR001881 1048 1087 SM00179 EGF-like calcium-binding
IPR006210 1051 1087 SM00181 EGF
IPR001881 1089 1125 SM00179 EGF-like calcium-binding
IPR003645 1092 1114 SM00274 Follistatin-like
IPR006210 1092 1125 SM00181 EGF
IPR001881 1128 1165 SM00179 EGF-like calcium-binding
IPR006210 1130 1165 SM00181 EGF
IPR001881 1167 1203 SM00179 EGF-like calcium-binding
IPR006210 1170 1203 SM00181 EGF
IPR003645 1170 1192 SM00274 Follistatin-like
IPR006210 1214 1247 SM00181 EGF
IPR003645 1214 1236 SM00274 Follistatin-like
IPR001881 1215 1247 SM00179 EGF-like calcium-binding
IPR001791 1270 1406 SM00282 Laminin G
IPR006210 1425 1458 SM00181 EGF
IPR006210 1464 1497 SM00181 EGF
IPR001881 1465 1497 SM00179 EGF-like calcium-binding
IPR006210 1505 1538 SM00181 EGF
IPR003645 1505 1527 SM00274 Follistatin-like
IPR006207 1549 1618 SM00041 Cystine knot
ProfileScan IPR000742 1011 1046 PS50026 EGF-like
IPR000742 1048 1087 PS50026 EGF-like
IPR000742 1089 1125 PS50026 EGF-like
IPR000742 1127 1165 PS50026 EGF-like
IPR000742 1167 1203 PS50026 EGF-like
IPR000742 1211 1247 PS50026 EGF-like
IPR001791 1250 1423 PS50025 Laminin G
IPR000742 1424 1458 PS50026 EGF-like
IPR000742 1461 1497 PS50026 EGF-like
IPR000742 1502 1538 PS50026 EGF-like
IPR006207 1543 1618 PS01225 Cystine knot
ScanRegExp IPR013032 1034 1045 PS00022 EGF-like region
IPR013032 1034 1045 PS01186 EGF-like region
IPR013032 1075 1086 PS00022 EGF-like region
IPR013032 1075 1086 PS01186 EGF-like region
IPR001881 1089 1113 PS01187 EGF-like calcium-binding
IPR000152 1104 1115 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1113 1124 PS00022 EGF-like region
IPR013032 1153 1164 PS00022 EGF-like region
IPR013032 1153 1164 PS01186 EGF-like region
IPR001881 1167 1191 PS01187 EGF-like calcium-binding
IPR000152 1182 1193 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1191 1202 PS00022 EGF-like region
IPR013032 1191 1202 PS01186 EGF-like region
IPR013032 1235 1246 PS00022 EGF-like region
IPR013032 1235 1246 PS01186 EGF-like region
IPR013032 1446 1457 PS00022 EGF-like region
IPR013032 1446 1457 PS01186 EGF-like region
IPR013032 1485 1496 PS00022 EGF-like region
IPR013032 1485 1496 PS01186 EGF-like region
IPR013032 1526 1537 PS00022 EGF-like region
IPR013032 1526 1537 PS01186 EGF-like region
IPR006207 1581 1617 PS01185 Cystine knot
Experimental conditions
Primer_f
Primer_r
PCR conditions °C sec °C sec cycles

RH mapping information
Description

Chromosome No. 10
Experimental conditions
Panel name GeneBridge 4
Primer_f AAACAATACTTCCAGGGCAGG
Primer_r TCAGATGCTATGTGGTCGTGG
PCR product length 135 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp