KIAA1722

Product ID	ORK00901
Accession No	AB051509
Description	Rho GTPase activating protein 35
Clone name	pf00674s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-375) was subcloned upstream of the cDNA (376-7692). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCCACGCGT-5' end of cDNA.
cDNA sequence	DNA sequence (7692 bp) Predicted protein sequence (1499 aa)
HaloTag ORF Clone	FHC00901
Flexi ORF Clone	FXC00901
Source	Human brain (hippocampus)
Rouge ID	mKIAA1722 by Kazusa Mouse cDNA Project
Note	We replaced pf00674, former representative clones for KIAA1722 with pf00674s1. (2002/5/10)

Length: 7692 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3192 bp
Genome contig ID	gi42406306f_52013773
PolyA signal sequence (None)	+--------+--------+----*----+---- AGTTTCTGTCGCGGGTCCGGTGGGGGCGCGGCCGC
Flanking genome sequence (185633 - 185682)	----+--------+--------+--------+--------+----* GGTGCGGTCGGTGCAGCGTGGCCAATGCGCGGCGCGCGCGGGGGACAGAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	52113773	52199404	7	99.5	Perfect prediction

Length: 1499 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW57451	100.0	glucocorticoid ...	Homo sapiens
XP_001112719	99.7	similar to gluc...	Macaca mulatta
Q9NRY4	99.9	Glucocorticoid ...	Homo sapiens
P83509	98.8	Glucocorticoid ...	Canis lupus fam...
XP_593095	98.1	similar to gluc...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040934	8.4e-10	27.5	KIAA1501
AB014572	5.8e-09	28.7	KIAA0672
AB037845	1.1e-08	27.6	KIAA1424
AB014521	1.1e-07	28.3	KIAA0621
AB007871	2.8e-07	30.9	KIAA0411

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013753	212	249	PF00071	Ras
	IPR002713	487	547	PF01846	FF
	IPR000198	1262	1413	PF00620	RhoGAP
HMMSmart	IPR002713	270	327	SM00441	FF
	IPR002713	369	422	SM00441	FF
	IPR002713	429	483	SM00441	FF
	IPR002713	485	539	SM00441	FF
	IPR000198	1259	1433	SM00324	RhoGAP
ProfileScan	IPR000198	1249	1436	PS50238	RhoGAP

Primer_f	TTTATGAACTGGAGCTGGATG
Primer_r	GTCTCCTTTGTTGGGTGGTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-