KIAA1733

Product ID	ORK00904
Accession No	AB051520
Description	phosphatase and actin regulator 1
Clone name	ph00321
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4784 bp) Predicted protein sequence (509 aa)
HaloTag ORF Clone	FHC00904
Flexi ORF Clone	FXC00904
Source	Human brain (hippocampus)

Length: 4784 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3200 bp
Genome contig ID	gi89161210f_12725879
PolyA signal sequence (None)	+--------+--------+----*----+---- GTTTAATGGGCTTTTATTCAAGAGAAATTTGCATT
Flanking genome sequence (658457 - 658506)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAACCTCTCCGGGAGGGAGATAGGATCTCTAAATCCAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	12825879	13384334	10	99.3	Perfect prediction

Length: 509 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI20986	1.2e-176	100.0	RPEL repeat con...	Homo sapiens
Q9C0D0	7.4e-176	100.0	Phosphatase and...	Homo sapiens
XP_001168684	8e-175	99.8	phosphatase and...	Pan troglodytes
XP_001168659	8.5e-175	99.8	phosphatase and...	Pan troglodytes
XP_001492193	1e-171	97.9	phosphatase and...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014580	1.4e-11	31.9	KIAA0680

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004018	163	188	PF02755	RPEL repeat
	IPR004018	447	472	PF02755	RPEL repeat
	IPR004018	485	509	PF02755	RPEL repeat
HMMSmart	IPR004018	163	188	SM00707	RPEL repeat
	IPR004018	447	472	SM00707	RPEL repeat
	IPR004018	485	509	SM00707	RPEL repeat
ProfileScan	IPR004018	163	188	PS51073	RPEL repeat
	IPR004018	447	472	PS51073	RPEL repeat
	IPR004018	485	509	PS51073	RPEL repeat

Primer_f	TCCAGAAATAAGACAAGTGCC
Primer_r	CTGGTGTATAATGAGCTGTCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-