HUGE |
Gene/Protein Characteristic Table for KIAA0134 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04769 |
---|---|
Accession No. : | D50924 |
Description : | Probable ATP-dependent RNA helicase DHX34. |
HUGO Gene Name : | DEAH (Asp-Glu-Ala-His) box polypeptide 34 (DHX34) |
Clone Name : | ha04001 [Vector Info] |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4345 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 2328 bp Genome contig ID gi42406306f_52447850 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CCTGGTTGACAGAGCAAGACTCCGTCTCAAAAAAGFlanking genome sequence
(133868 - 133917) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAGAAAACCCGTCTCTACTAAAAATACAAAATT
Chr f/r start end exon identity class ContigView(URL based/DAS) 19 f 52547850 52581716 13 99.0 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 587 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 19 |
: Stanford G3 | |
: TGCAGGTGGGGAATGGATGAG | |
: CCAGTCCCATTTCTCCAAGGC | |
: 162 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |