HUGE

Gene/Protein Characteristic Table for KIAA0134

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04769
Accession No. :	D50924
Description :	Probable ATP-dependent RNA helicase DHX34.
HUGO Gene Name :	DEAH (Asp-Glu-Ala-His) box polypeptide 34 (DHX34)
Clone Name :	ha04001 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 4345 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2328 bp

Genome contig ID gi42406306f_52447850
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CCTGGTTGACAGAGCAAGACTCCGTCTCAAAAAAG
Flanking genome sequence
(133868 - 133917)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAGAAAACCCGTCTCTACTAAAAATACAAAATT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 52547850 52581716 13 99.0 Terminal No-hit

Features of the protein sequence	Description

Length: 587 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q14147	0	100.0	Probable ATP-de...	Homo sapiens
EAW57473	0	99.7	DEAH (Asp-Glu-A...	Homo sapiens
EAW57477	8.8e-151	77.2	DEAH (Asp-Glu-A...	Homo sapiens
BAG65475	3e-136	100.0	unnamed protein...	Homo sapiens
EAW57474	4.6e-136	86.5	DEAH (Asp-Glu-A...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011149	1.8e-28	31.9	KIAA0577
AB040921	2.4e-27	31.9	KIAA1488
D86977	6.3e-25	36.5	KIAA0224
AB020697	5.2e-21	30.6	KIAA0890
AB040950	6.7e-19	28.8	KIAA1517

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001650 358 422 PF00271 DNA/RNA helicase

IPR007502 482 546 PF04408 Helicase-associated region

HMMSmart IPR014001 159 352 SM00487 DEAD-like helicases

IPR001650 300 422 SM00490 DNA/RNA helicase

ProfileScan IPR014021 183 343 PS51192 Helicase

IPR001650 280 462 PS51194 DNA/RNA helicase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001650	358	422	PF00271	DNA/RNA helicase
IPR007502	482	546	PF04408	Helicase-associated region
HMMSmart	IPR014001	159	352	SM00487	DEAD-like helicases
IPR001650	300	422	SM00490	DNA/RNA helicase
ProfileScan	IPR014021	183	343	PS51192	Helicase
IPR001650	280	462	PS51194	DNA/RNA helicase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: Stanford G3
Primer_f	: TGCAGGTGGGGAATGGATGAG
Primer_r	: CCAGTCCCATTTCTCCAAGGC
PCR product length	: 162 bp
PCR conditions	: 95 °C15 sec64 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2328 bp
Genome contig ID	gi42406306f_52447850
PolyA signal sequence (None)	+--------+--------+----*----+---- CCTGGTTGACAGAGCAAGACTCCGTCTCAAAAAAG
Flanking genome sequence (133868 - 133917)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAGAAAACCCGTCTCTACTAAAAATACAAAATT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	52547850	52581716	13	99.0	Terminal No-hit

Gene/Protein Characteristic Table for KIAA0134

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information