HUGE

Gene/Protein Characteristic Table for KIAA0224

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00469
Accession No. :	D86977
Description :	Pre-mRNA-splicing factor ATP-dependent RNA helicase PRP16.
HUGO Gene Name :	DEAH (Asp-Glu-Ala-His) box polypeptide 38 (DHX38)
Clone Name :	ha04657 [Vector Info]
Flexi ORF Clone :	pF1KSDA0224
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 4226 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 406 bp

Genome contig ID gi51511732f_70585335
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
ATAATTCAGGATTTGGAAATAAATTTATTATTTGT
Flanking genome sequence
(118970 - 119019)
----+----*----+----*----+----*----+----*----+----*
AAAACATGACTGCATGTCTGACTTTTTCCTTCACCCTCTTAAATCATGTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 70685335 70704303 27 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1256 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_511101	99.7	DEAH (Asp-Glu-A...	Pan troglodytes
XP_001097681	99.3	similar to DEAH...	Macaca mulatta
AAC39729	100.0	pre-mRNA splici...	Homo sapiens
BAF84323	99.8	unnamed protein...	Homo sapiens
CAH92898	99.1	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011149	6.5e-85	41.0	KIAA0577
AB040921	3.9e-19	30.0	KIAA1488
D50924	1.7e-16	36.5	KIAA0134
AB020697	1.8e-14	30.2	KIAA0890
AB040950	7.8e-13	30.9	KIAA1517

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001650 796 890 PF00271 DNA/RNA helicase

IPR007502 951 1041 PF04408 Helicase-associated region

IPR011709 1075 1177 PF07717 Domain of unknown function DUF1605

HMMSmart IPR014001 559 743 SM00487 DEAD-like helicases

IPR001650 787 890 SM00490 DNA/RNA helicase

ProfileScan IPR014021 571 734 PS51192 Helicase

IPR001650 756 931 PS51194 DNA/RNA helicase

ScanRegExp IPR002464 676 685 PS00690 DNA/RNA helicase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001650	796	890	PF00271	DNA/RNA helicase
IPR007502	951	1041	PF04408	Helicase-associated region
IPR011709	1075	1177	PF07717	Domain of unknown function DUF1605
HMMSmart	IPR014001	559	743	SM00487	DEAD-like helicases
IPR001650	787	890	SM00490	DNA/RNA helicase
ProfileScan	IPR014021	571	734	PS51192	Helicase
IPR001650	756	931	PS51194	DNA/RNA helicase
ScanRegExp	IPR002464	676	685	PS00690	DNA/RNA helicase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: GGCTGCAGAGTATCCGAGGTG
Primer_r	: CAGCCAAGTCACGCATACACC
PCR product length	: 101 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	406 bp
Genome contig ID	gi51511732f_70585335
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- ATAATTCAGGATTTGGAAATAAATTTATTATTTGT
Flanking genome sequence (118970 - 119019)	----+--------+--------+--------+--------+----* AAAACATGACTGCATGTCTGACTTTTTCCTTCACCCTCTTAAATCATGTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	70685335	70704303	27	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0224

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information