HUGE |
Gene/Protein Characteristic Table for KIAA0224 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00469 |
---|---|
Accession No. : | D86977 |
Description : | Pre-mRNA-splicing factor ATP-dependent RNA helicase PRP16. |
HUGO Gene Name : | DEAH (Asp-Glu-Ala-His) box polypeptide 38 (DHX38) |
Clone Name : | ha04657 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0224
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4226 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 406 bp Genome contig ID gi51511732f_70585335 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
ATAATTCAGGATTTGGAAATAAATTTATTATTTGTFlanking genome sequence
(118970 - 119019) ----+----*----+----*----+----*----+----*----+----*
AAAACATGACTGCATGTCTGACTTTTTCCTTCACCCTCTTAAATCATGTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 16 f 70685335 70704303 27 99.7 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1256 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 16 |
: Genebridge 4 | |
: GGCTGCAGAGTATCCGAGGTG | |
: CAGCCAAGTCACGCATACACC | |
: 101 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |