HUGE

Gene/Protein Characteristic Table for KIAA1517

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB040950
Description :	Probable ATP-dependent RNA helicase DHX37.
HUGO Gene Name :	DEAH (Asp-Glu-Ala-His) box polypeptide 37 (DHX37)
Clone Name :	fh11426 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5421 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 1113 bp

Genome contig ID gi89161190r_123897330
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
CGGTGGAGACAGTTATGGAATAAAATGTTCCTTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCCAGATTGTGTTGTGGAATGCACTTGGGGAAGGACACCCAGGTGGCCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 r 123997330 124031197 23 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 998 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW98467	99.8	DEAH (Asp-Glu-A...	Homo sapiens
Q8IY37	99.9	Probable ATP-de...	Homo sapiens
EAW98468	99.8	DEAH (Asp-Glu-A...	Homo sapiens
AAH02575	99.7	DHX37 protein [...	Homo sapiens
XP_001103101	94.5	similar to DEAH...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011149	4.6e-11	32.8	KIAA0577
AB040921	1.4e-10	28.2	KIAA1488
D86977	2.3e-10	30.8	KIAA0224
D50924	5.5e-10	28.8	KIAA0134
AB020697	5.1e-07	27.7	KIAA0890

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001650 408 499 PF00271 DNA/RNA helicase

IPR007502 559 682 PF04408 Helicase-associated region

IPR011709 716 834 PF07717 Domain of unknown function DUF1605

HMMSmart IPR014001 74 265 SM00487 DEAD-like helicases

IPR001650 380 499 SM00490 DNA/RNA helicase

ProfileScan IPR014021 85 252 PS51192 Helicase

IPR001650 282 539 PS51194 DNA/RNA helicase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001650	408	499	PF00271	DNA/RNA helicase
IPR007502	559	682	PF04408	Helicase-associated region
IPR011709	716	834	PF07717	Domain of unknown function DUF1605
HMMSmart	IPR014001	74	265	SM00487	DEAD-like helicases
IPR001650	380	499	SM00490	DNA/RNA helicase
ProfileScan	IPR014021	85	252	PS51192	Helicase
IPR001650	282	539	PS51194	DNA/RNA helicase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGGTCCCCCAGCAAGAAAGAG

Primer_r
: CATAACTGTCTCCACCGAAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGGTCCCCCAGCAAGAAAGAG
Primer_r	: CATAACTGTCTCCACCGAAGC
PCR product length	: 174 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	1113 bp
Genome contig ID	gi89161190r_123897330
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- CGGTGGAGACAGTTATGGAATAAAATGTTCCTTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCCAGATTGTGTTGTGGAATGCACTTGGGGAAGGACACCCAGGTGGCCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	r	123997330	124031197	23	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1517

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information